Incidental Mutation 'R2925:Fuom'
ID255707
Institutional Source Beutler Lab
Gene Symbol Fuom
Ensembl Gene ENSMUSG00000025466
Gene Namefucose mutarotase
Synonyms1810014F10Rik
MMRRC Submission 040510-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R2925 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140096770-140102441 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140099949 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 110 (T110A)
Ref Sequence ENSEMBL: ENSMUSP00000120353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026539] [ENSMUST00000026540] [ENSMUST00000120034] [ENSMUST00000121115] [ENSMUST00000142105] [ENSMUST00000148716]
Predicted Effect probably benign
Transcript: ENSMUST00000026539
AA Change: T110A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026539
Gene: ENSMUSG00000025466
AA Change: T110A

DomainStartEndE-ValueType
Pfam:RbsD_FucU 5 148 1.3e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026540
SMART Domains Protein: ENSMUSP00000026540
Gene: ENSMUSG00000025467

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:PRAP 100 144 1.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120034
AA Change: T110A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112429
Gene: ENSMUSG00000025466
AA Change: T110A

DomainStartEndE-ValueType
Pfam:RbsD_FucU 5 134 5.9e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121115
SMART Domains Protein: ENSMUSP00000112970
Gene: ENSMUSG00000025466

DomainStartEndE-ValueType
Pfam:RbsD_FucU 5 117 9.1e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125421
Predicted Effect probably benign
Transcript: ENSMUST00000128527
SMART Domains Protein: ENSMUSP00000118717
Gene: ENSMUSG00000025466

DomainStartEndE-ValueType
Pfam:RbsD_FucU 1 105 4.4e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138197
Predicted Effect probably benign
Transcript: ENSMUST00000142105
AA Change: T105A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115799
Gene: ENSMUSG00000025466
AA Change: T105A

DomainStartEndE-ValueType
Pfam:RbsD_FucU 1 134 3e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143197
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147713
Predicted Effect probably benign
Transcript: ENSMUST00000148716
AA Change: T110A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120353
Gene: ENSMUSG00000025466
AA Change: T110A

DomainStartEndE-ValueType
Pfam:RbsD_FucU 5 133 7.8e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155777
Predicted Effect probably benign
Transcript: ENSMUST00000211677
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 95% (40/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit reduced female sexual receptivity and masculinized sexual behaviors in female mice. Heterozygous mice exhibit intermediate phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503E14Rik T C 14: 44,170,298 T93A probably damaging Het
4932438A13Rik G T 3: 37,007,122 A3327S probably damaging Het
9530003J23Rik C T 10: 117,234,431 R147Q probably benign Het
AI314180 T A 4: 58,833,928 K851* probably null Het
Akr1c21 A G 13: 4,576,350 probably null Het
Alk A G 17: 72,603,207 V168A probably benign Het
Ap4b1 A G 3: 103,820,681 E337G probably damaging Het
Btn2a2 A G 13: 23,481,814 S283P probably damaging Het
Ctcfl C T 2: 173,094,696 E628K probably damaging Het
Cul9 G A 17: 46,510,981 T1856M probably benign Het
Defb41 T C 1: 18,260,633 D30G probably damaging Het
Dnaic1 A T 4: 41,597,919 I74F probably damaging Het
Fbln2 T A 6: 91,265,855 C846S probably damaging Het
Gm498 A T 7: 143,883,999 R147* probably null Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Il12a TCAC TC 3: 68,697,987 probably null Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Man2b2 A G 5: 36,824,102 F224L probably benign Het
Mtbp G A 15: 55,619,814 R429Q probably benign Het
Ncapg2 C A 12: 116,438,729 T727K probably benign Het
Nek4 G A 14: 30,951,710 G29S probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Nup214 A G 2: 31,998,003 K15E probably damaging Het
Olfr1029 T A 2: 85,975,781 C179* probably null Het
Olfr1079 C T 2: 86,538,547 D121N probably damaging Het
Olfr206 A T 16: 59,345,343 Y119* probably null Het
Olfr460 T A 6: 40,571,408 S7R probably benign Het
P2ry13 G A 3: 59,209,380 H326Y probably benign Het
Plec A G 15: 76,178,252 F2563S probably damaging Het
Rc3h1 A G 1: 160,954,976 Y675C probably damaging Het
Samd3 T A 10: 26,251,887 S288T probably benign Het
Scaf4 G T 16: 90,250,289 P400Q unknown Het
Selplg T C 5: 113,820,179 D22G possibly damaging Het
Slc30a6 T C 17: 74,402,004 probably benign Het
Syt3 T A 7: 44,395,798 V518E probably damaging Het
Tnks G A 8: 34,965,661 A2V unknown Het
Upk3a A G 15: 85,018,149 Y59C probably benign Het
Usp4 T C 9: 108,367,856 L331P probably damaging Het
Zbed5 A G 5: 129,903,198 T663A possibly damaging Het
Zbtb11 G A 16: 55,974,084 R8Q probably benign Het
Other mutations in Fuom
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1248:Fuom UTSW 7 140099718 splice site probably benign
R1938:Fuom UTSW 7 140099608 missense probably benign 0.01
R2924:Fuom UTSW 7 140099949 missense probably benign
R4722:Fuom UTSW 7 140099567 unclassified probably benign
R5542:Fuom UTSW 7 140100112 makesense probably null
R5958:Fuom UTSW 7 140099898 missense probably damaging 1.00
R7392:Fuom UTSW 7 140101160 missense probably damaging 1.00
R7734:Fuom UTSW 7 140099542 missense unknown
Predicted Primers PCR Primer
(F):5'- TGCTGGGACTCCAACTTTGC -3'
(R):5'- TCTCTGGATCCTTGAAACTCCAG -3'

Sequencing Primer
(F):5'- GGGACTCCAACTTTGCTCTCAGAG -3'
(R):5'- TGGATCCTTGAAACTCCAGCATCAG -3'
Posted On2014-12-29