Incidental Mutation 'R2925:Tnks'
ID 255709
Institutional Source Beutler Lab
Gene Symbol Tnks
Ensembl Gene ENSMUSG00000031529
Gene Name tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
Synonyms mTNKS1, TANK1, tankyrase 1, 4930554K12Rik, D130072O21Rik
MMRRC Submission 040510-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2925 (G1)
Quality Score 197
Status Validated
Chromosome 8
Chromosomal Location 35296333-35432844 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 35432815 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 2 (A2V)
Ref Sequence ENSEMBL: ENSMUSP00000033929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033929]
AlphaFold Q6PFX9
PDB Structure Crystal structure of a mouse Tankyrase-Axin complex [X-RAY DIFFRACTION]
Co-crystal structure of tankyrase 1 with compound 3 [(4S)-3-{4-[6-amino-5-(pyrimidin-2-yl)pyridin-3-yl]phenyl}-5,5-dimethyl-4-phenyl-1,3-oxazolidin-2-one] [X-RAY DIFFRACTION]
Predicted Effect unknown
Transcript: ENSMUST00000033929
AA Change: A2V
SMART Domains Protein: ENSMUSP00000033929
Gene: ENSMUSG00000031529
AA Change: A2V

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 20 55 N/A INTRINSIC
low complexity region 68 86 N/A INTRINSIC
low complexity region 91 175 N/A INTRINSIC
ANK 208 237 4.26e-4 SMART
ANK 241 270 3.23e-4 SMART
ANK 274 303 3.28e-5 SMART
ANK 327 355 2.66e3 SMART
ANK 361 390 7.64e-6 SMART
ANK 394 423 2.62e-4 SMART
ANK 427 456 1.99e-4 SMART
ANK 514 546 3.18e-3 SMART
ANK 550 579 1.51e-4 SMART
ANK 583 612 4.26e-4 SMART
ANK 642 670 2.21e3 SMART
ANK 676 705 4.03e-5 SMART
ANK 709 738 2.48e-5 SMART
ANK 742 771 1.64e-5 SMART
low complexity region 792 810 N/A INTRINSIC
ANK 829 858 1.47e-7 SMART
ANK 862 891 2.21e-2 SMART
ANK 895 924 3.13e-2 SMART
low complexity region 996 1010 N/A INTRINSIC
SAM 1017 1082 1.14e-12 SMART
Pfam:PARP 1098 1303 1.5e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000067161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210951
Meta Mutation Damage Score 0.1336 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 95% (40/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele fail to exhibit any abonormalities. Male mice homozygous for a gene trapped allele exhibit decreased fat pad weight, increased metabolism, hyperinsulinemia, and hypoglycemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503E14Rik T C 14: 44,407,755 (GRCm39) T93A probably damaging Het
Acte1 A T 7: 143,437,736 (GRCm39) R147* probably null Het
Akr1c21 A G 13: 4,626,349 (GRCm39) probably null Het
Alk A G 17: 72,910,202 (GRCm39) V168A probably benign Het
Ap4b1 A G 3: 103,727,997 (GRCm39) E337G probably damaging Het
Bltp1 G T 3: 37,061,271 (GRCm39) A3327S probably damaging Het
Btn2a2 A G 13: 23,665,984 (GRCm39) S283P probably damaging Het
Ctcfl C T 2: 172,936,489 (GRCm39) E628K probably damaging Het
Cul9 G A 17: 46,821,907 (GRCm39) T1856M probably benign Het
Defb41 T C 1: 18,330,857 (GRCm39) D30G probably damaging Het
Dnai1 A T 4: 41,597,919 (GRCm39) I74F probably damaging Het
Ecpas T A 4: 58,833,928 (GRCm39) K851* probably null Het
Fbln2 T A 6: 91,242,837 (GRCm39) C846S probably damaging Het
Fuom T C 7: 139,679,862 (GRCm39) T110A probably benign Het
Hsp90aa1 C A 12: 110,662,115 (GRCm39) probably null Het
Hsp90aa1 T A 12: 110,662,114 (GRCm39) M1L possibly damaging Het
Il12a TCAC TC 3: 68,605,320 (GRCm39) probably null Het
Kcnd3 C T 3: 105,566,082 (GRCm39) A421V probably damaging Het
Lyz3 C T 10: 117,070,336 (GRCm39) R147Q probably benign Het
Man2b2 A G 5: 36,981,446 (GRCm39) F224L probably benign Het
Mtbp G A 15: 55,483,210 (GRCm39) R429Q probably benign Het
Ncapg2 C A 12: 116,402,349 (GRCm39) T727K probably benign Het
Nek4 G A 14: 30,673,667 (GRCm39) G29S probably benign Het
Nsf C T 11: 103,821,578 (GRCm39) E26K possibly damaging Het
Nup214 A G 2: 31,888,015 (GRCm39) K15E probably damaging Het
Or5ac24 A T 16: 59,165,706 (GRCm39) Y119* probably null Het
Or5m11b T A 2: 85,806,125 (GRCm39) C179* probably null Het
Or8k32 C T 2: 86,368,891 (GRCm39) D121N probably damaging Het
Or9a4 T A 6: 40,548,342 (GRCm39) S7R probably benign Het
P2ry13 G A 3: 59,116,801 (GRCm39) H326Y probably benign Het
Plec A G 15: 76,062,452 (GRCm39) F2563S probably damaging Het
Rc3h1 A G 1: 160,782,546 (GRCm39) Y675C probably damaging Het
Samd3 T A 10: 26,127,785 (GRCm39) S288T probably benign Het
Scaf4 G T 16: 90,047,177 (GRCm39) P400Q unknown Het
Selplg T C 5: 113,958,240 (GRCm39) D22G possibly damaging Het
Slc30a6 T C 17: 74,708,999 (GRCm39) probably benign Het
Syt3 T A 7: 44,045,222 (GRCm39) V518E probably damaging Het
Upk3a A G 15: 84,902,350 (GRCm39) Y59C probably benign Het
Usp4 T C 9: 108,245,055 (GRCm39) L331P probably damaging Het
Zbed5 A G 5: 129,932,039 (GRCm39) T663A possibly damaging Het
Zbtb11 G A 16: 55,794,447 (GRCm39) R8Q probably benign Het
Other mutations in Tnks
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Tnks APN 8 35,328,843 (GRCm39) splice site probably benign
IGL00901:Tnks APN 8 35,305,549 (GRCm39) nonsense probably null
IGL01448:Tnks APN 8 35,307,136 (GRCm39) missense probably damaging 1.00
IGL01455:Tnks APN 8 35,408,054 (GRCm39) missense probably damaging 0.99
IGL01962:Tnks APN 8 35,336,678 (GRCm39) missense probably damaging 1.00
IGL02088:Tnks APN 8 35,307,148 (GRCm39) missense possibly damaging 0.50
IGL02260:Tnks APN 8 35,310,137 (GRCm39) missense probably damaging 0.99
IGL02454:Tnks APN 8 35,298,882 (GRCm39) unclassified probably benign
IGL02486:Tnks APN 8 35,318,352 (GRCm39) missense probably damaging 1.00
IGL02612:Tnks APN 8 35,316,453 (GRCm39) missense possibly damaging 0.48
IGL03179:Tnks APN 8 35,315,824 (GRCm39) missense probably benign 0.38
IGL03404:Tnks APN 8 35,407,858 (GRCm39) missense probably damaging 1.00
R0256:Tnks UTSW 8 35,328,701 (GRCm39) missense probably benign 0.07
R0265:Tnks UTSW 8 35,307,124 (GRCm39) nonsense probably null
R0334:Tnks UTSW 8 35,320,413 (GRCm39) nonsense probably null
R0414:Tnks UTSW 8 35,320,463 (GRCm39) missense probably damaging 1.00
R0526:Tnks UTSW 8 35,320,457 (GRCm39) missense probably benign 0.23
R0622:Tnks UTSW 8 35,407,976 (GRCm39) missense probably damaging 1.00
R1445:Tnks UTSW 8 35,301,757 (GRCm39) splice site probably benign
R1618:Tnks UTSW 8 35,342,430 (GRCm39) missense probably damaging 1.00
R1779:Tnks UTSW 8 35,324,672 (GRCm39) missense probably benign 0.18
R1919:Tnks UTSW 8 35,342,386 (GRCm39) missense probably damaging 1.00
R1938:Tnks UTSW 8 35,305,684 (GRCm39) missense probably damaging 1.00
R2018:Tnks UTSW 8 35,318,260 (GRCm39) missense probably damaging 1.00
R2198:Tnks UTSW 8 35,340,221 (GRCm39) missense probably benign 0.29
R2198:Tnks UTSW 8 35,315,803 (GRCm39) missense probably benign
R3828:Tnks UTSW 8 35,340,332 (GRCm39) missense probably damaging 1.00
R3913:Tnks UTSW 8 35,340,228 (GRCm39) missense probably damaging 0.99
R3916:Tnks UTSW 8 35,320,515 (GRCm39) missense probably damaging 1.00
R3917:Tnks UTSW 8 35,320,515 (GRCm39) missense probably damaging 1.00
R3930:Tnks UTSW 8 35,407,966 (GRCm39) missense probably damaging 1.00
R4659:Tnks UTSW 8 35,316,465 (GRCm39) missense possibly damaging 0.53
R4760:Tnks UTSW 8 35,318,937 (GRCm39) missense probably benign 0.38
R5091:Tnks UTSW 8 35,308,963 (GRCm39) missense probably benign 0.40
R5419:Tnks UTSW 8 35,432,720 (GRCm39) missense unknown
R5558:Tnks UTSW 8 35,432,819 (GRCm39) start codon destroyed probably null
R5582:Tnks UTSW 8 35,408,015 (GRCm39) missense probably benign 0.14
R6035:Tnks UTSW 8 35,385,615 (GRCm39) missense possibly damaging 0.93
R6035:Tnks UTSW 8 35,385,615 (GRCm39) missense possibly damaging 0.93
R6495:Tnks UTSW 8 35,307,120 (GRCm39) critical splice donor site probably null
R6527:Tnks UTSW 8 35,340,247 (GRCm39) missense probably benign 0.36
R6991:Tnks UTSW 8 35,301,647 (GRCm39) missense probably damaging 1.00
R7015:Tnks UTSW 8 35,305,701 (GRCm39) missense probably benign 0.04
R7038:Tnks UTSW 8 35,318,790 (GRCm39) missense probably damaging 0.99
R7057:Tnks UTSW 8 35,307,168 (GRCm39) missense probably damaging 1.00
R7167:Tnks UTSW 8 35,316,458 (GRCm39) missense probably damaging 0.98
R7250:Tnks UTSW 8 35,318,912 (GRCm39) missense probably damaging 0.98
R7475:Tnks UTSW 8 35,298,866 (GRCm39) missense probably damaging 1.00
R7790:Tnks UTSW 8 35,328,694 (GRCm39) missense probably benign 0.01
R7818:Tnks UTSW 8 35,340,182 (GRCm39) missense probably benign 0.03
R7909:Tnks UTSW 8 35,407,858 (GRCm39) missense probably damaging 1.00
R7970:Tnks UTSW 8 35,323,080 (GRCm39) critical splice donor site probably null
R8341:Tnks UTSW 8 35,340,199 (GRCm39) missense probably damaging 1.00
R8343:Tnks UTSW 8 35,301,738 (GRCm39) missense probably benign 0.03
R8870:Tnks UTSW 8 35,314,433 (GRCm39) critical splice donor site probably null
R8936:Tnks UTSW 8 35,320,501 (GRCm39) nonsense probably null
R9049:Tnks UTSW 8 35,308,932 (GRCm39) missense probably damaging 0.96
R9080:Tnks UTSW 8 35,432,466 (GRCm39) small deletion probably benign
R9182:Tnks UTSW 8 35,308,905 (GRCm39) critical splice donor site probably null
R9211:Tnks UTSW 8 35,316,489 (GRCm39) missense probably damaging 1.00
R9425:Tnks UTSW 8 35,340,819 (GRCm39) missense probably damaging 1.00
R9649:Tnks UTSW 8 35,306,089 (GRCm39) missense probably damaging 0.96
Z1177:Tnks UTSW 8 35,432,299 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AAAGTTGCCGTGGAGCCAAC -3'
(R):5'- TTCAAATCTGCCCAGCCAGC -3'

Sequencing Primer
(F):5'- ACTCTCCGCTAAGCTCGAG -3'
(R):5'- GCCCGTCGCTCCACTACTAAG -3'
Posted On 2014-12-29