Mutagenetix > Incidental Mutations

Incidental Mutation 'R2925:Tnks'

255709

Institutional Source

Beutler Lab

Gene Symbol

Tnks

Ensembl Gene

ENSMUSG00000031529

Gene Name

tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase

Synonyms

mTNKS1, 4930554K12Rik, D130072O21Rik, TANK1, tankyrase 1

MMRRC Submission

040510-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2925 (G1)

Quality Score

197

Status

Validated

Chromosome

Chromosomal Location

34826460-34965690 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 34965661 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 2 (A2V)

Ref Sequence

ENSEMBL: ENSMUSP00000033929 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033929]

PDB Structure

Crystal structure of a mouse Tankyrase-Axin complex [X-RAY DIFFRACTION]
Co-crystal structure of tankyrase 1 with compound 3 [(4S)-3-{4-[6-amino-5-(pyrimidin-2-yl)pyridin-3-yl]phenyl}-5,5-dimethyl-4-phenyl-1,3-oxazolidin-2-one] [X-RAY DIFFRACTION]

Predicted Effect

unknown
Transcript: ENSMUST00000033929
AA Change: A2V

SMART Domains

Protein: ENSMUSP00000033929
Gene: ENSMUSG00000031529
AA Change: A2V

Domain	Start	End	E-Value	Type
low complexity region	8	17	N/A	INTRINSIC
low complexity region	20	55	N/A	INTRINSIC
low complexity region	68	86	N/A	INTRINSIC
low complexity region	91	175	N/A	INTRINSIC
ANK	208	237	4.26e-4	SMART
ANK	241	270	3.23e-4	SMART
ANK	274	303	3.28e-5	SMART
ANK	327	355	2.66e3	SMART
ANK	361	390	7.64e-6	SMART
ANK	394	423	2.62e-4	SMART
ANK	427	456	1.99e-4	SMART
ANK	514	546	3.18e-3	SMART
ANK	550	579	1.51e-4	SMART
ANK	583	612	4.26e-4	SMART
ANK	642	670	2.21e3	SMART
ANK	676	705	4.03e-5	SMART
ANK	709	738	2.48e-5	SMART
ANK	742	771	1.64e-5	SMART
low complexity region	792	810	N/A	INTRINSIC
ANK	829	858	1.47e-7	SMART
ANK	862	891	2.21e-2	SMART
ANK	895	924	3.13e-2	SMART
low complexity region	996	1010	N/A	INTRINSIC
SAM	1017	1082	1.14e-12	SMART
Pfam:PARP	1098	1303	1.5e-28	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000067161

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209512

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210603

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210951

Meta Mutation Damage Score

0.1336

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

95% (40/42)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele fail to exhibit any abonormalities. Male mice homozygous for a gene trapped allele exhibit decreased fat pad weight, increased metabolism, hyperinsulinemia, and hypoglycemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503E14Rik	T	C	14: 44,170,298	T93A	probably damaging	Het
4932438A13Rik	G	T	3: 37,007,122	A3327S	probably damaging	Het
9530003J23Rik	C	T	10: 117,234,431	R147Q	probably benign	Het
AI314180	T	A	4: 58,833,928	K851*	probably null	Het
Akr1c21	A	G	13: 4,576,350		probably null	Het
Alk	A	G	17: 72,603,207	V168A	probably benign	Het
Ap4b1	A	G	3: 103,820,681	E337G	probably damaging	Het
Btn2a2	A	G	13: 23,481,814	S283P	probably damaging	Het
Ctcfl	C	T	2: 173,094,696	E628K	probably damaging	Het
Cul9	G	A	17: 46,510,981	T1856M	probably benign	Het
Defb41	T	C	1: 18,260,633	D30G	probably damaging	Het
Dnaic1	A	T	4: 41,597,919	I74F	probably damaging	Het
Fbln2	T	A	6: 91,265,855	C846S	probably damaging	Het
Fuom	T	C	7: 140,099,949	T110A	probably benign	Het
Gm498	A	T	7: 143,883,999	R147*	probably null	Het
Hsp90aa1	T	A	12: 110,695,680	M1L	possibly damaging	Het
Hsp90aa1	C	A	12: 110,695,681		probably null	Het
Il12a	TCAC	TC	3: 68,697,987		probably null	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Man2b2	A	G	5: 36,824,102	F224L	probably benign	Het
Mtbp	G	A	15: 55,619,814	R429Q	probably benign	Het
Ncapg2	C	A	12: 116,438,729	T727K	probably benign	Het
Nek4	G	A	14: 30,951,710	G29S	probably benign	Het
Nsf	C	T	11: 103,930,752	E26K	possibly damaging	Het
Nup214	A	G	2: 31,998,003	K15E	probably damaging	Het
Olfr1029	T	A	2: 85,975,781	C179*	probably null	Het
Olfr1079	C	T	2: 86,538,547	D121N	probably damaging	Het
Olfr206	A	T	16: 59,345,343	Y119*	probably null	Het
Olfr460	T	A	6: 40,571,408	S7R	probably benign	Het
P2ry13	G	A	3: 59,209,380	H326Y	probably benign	Het
Plec	A	G	15: 76,178,252	F2563S	probably damaging	Het
Rc3h1	A	G	1: 160,954,976	Y675C	probably damaging	Het
Samd3	T	A	10: 26,251,887	S288T	probably benign	Het
Scaf4	G	T	16: 90,250,289	P400Q	unknown	Het
Selplg	T	C	5: 113,820,179	D22G	possibly damaging	Het
Slc30a6	T	C	17: 74,402,004		probably benign	Het
Syt3	T	A	7: 44,395,798	V518E	probably damaging	Het
Upk3a	A	G	15: 85,018,149	Y59C	probably benign	Het
Usp4	T	C	9: 108,367,856	L331P	probably damaging	Het
Zbed5	A	G	5: 129,903,198	T663A	possibly damaging	Het
Zbtb11	G	A	16: 55,974,084	R8Q	probably benign	Het

Other mutations in Tnks

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00498:Tnks	APN	8	34861689	splice site	probably benign
IGL00901:Tnks	APN	8	34838395	nonsense	probably null
IGL01448:Tnks	APN	8	34839982	missense	probably damaging	1.00
IGL01455:Tnks	APN	8	34940900	missense	probably damaging	0.99
IGL01962:Tnks	APN	8	34869524	missense	probably damaging	1.00
IGL02088:Tnks	APN	8	34839994	missense	possibly damaging	0.50
IGL02260:Tnks	APN	8	34842983	missense	probably damaging	0.99
IGL02454:Tnks	APN	8	34831728	unclassified	probably benign
IGL02486:Tnks	APN	8	34851198	missense	probably damaging	1.00
IGL02612:Tnks	APN	8	34849299	missense	possibly damaging	0.48
IGL03179:Tnks	APN	8	34848670	missense	probably benign	0.38
IGL03404:Tnks	APN	8	34940704	missense	probably damaging	1.00
R0256:Tnks	UTSW	8	34861547	missense	probably benign	0.07
R0265:Tnks	UTSW	8	34839970	nonsense	probably null
R0334:Tnks	UTSW	8	34853259	nonsense	probably null
R0414:Tnks	UTSW	8	34853309	missense	probably damaging	1.00
R0526:Tnks	UTSW	8	34853303	missense	probably benign	0.23
R0622:Tnks	UTSW	8	34940822	missense	probably damaging	1.00
R1445:Tnks	UTSW	8	34834603	splice site	probably benign
R1618:Tnks	UTSW	8	34875276	missense	probably damaging	1.00
R1779:Tnks	UTSW	8	34857518	missense	probably benign	0.18
R1919:Tnks	UTSW	8	34875232	missense	probably damaging	1.00
R1938:Tnks	UTSW	8	34838530	missense	probably damaging	1.00
R2018:Tnks	UTSW	8	34851106	missense	probably damaging	1.00
R2198:Tnks	UTSW	8	34848649	missense	probably benign
R2198:Tnks	UTSW	8	34873067	missense	probably benign	0.29
R3828:Tnks	UTSW	8	34873178	missense	probably damaging	1.00
R3913:Tnks	UTSW	8	34873074	missense	probably damaging	0.99
R3916:Tnks	UTSW	8	34853361	missense	probably damaging	1.00
R3917:Tnks	UTSW	8	34853361	missense	probably damaging	1.00
R3930:Tnks	UTSW	8	34940812	missense	probably damaging	1.00
R4659:Tnks	UTSW	8	34849311	missense	possibly damaging	0.53
R4760:Tnks	UTSW	8	34851783	missense	probably benign	0.38
R5091:Tnks	UTSW	8	34841809	missense	probably benign	0.40
R5419:Tnks	UTSW	8	34965566	missense	unknown
R5558:Tnks	UTSW	8	34965665	start codon destroyed	probably null
R5582:Tnks	UTSW	8	34940861	missense	probably benign	0.14
R6035:Tnks	UTSW	8	34918461	missense	possibly damaging	0.93
R6035:Tnks	UTSW	8	34918461	missense	possibly damaging	0.93
R6495:Tnks	UTSW	8	34839966	critical splice donor site	probably null
R6527:Tnks	UTSW	8	34873093	missense	probably benign	0.36
R6991:Tnks	UTSW	8	34834493	missense	probably damaging	1.00
R7015:Tnks	UTSW	8	34838547	missense	probably benign	0.04
R7038:Tnks	UTSW	8	34851636	missense	probably damaging	0.99
R7057:Tnks	UTSW	8	34840014	missense	probably damaging	1.00
R7167:Tnks	UTSW	8	34849304	missense	probably damaging	0.98
R7250:Tnks	UTSW	8	34851758	missense	probably damaging	0.98
R7475:Tnks	UTSW	8	34831712	missense	probably damaging	1.00
R7790:Tnks	UTSW	8	34861540	missense	probably benign	0.01
R7818:Tnks	UTSW	8	34873028	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- AAAGTTGCCGTGGAGCCAAC -3'
(R):5'- TTCAAATCTGCCCAGCCAGC -3'

Sequencing Primer
(F):5'- ACTCTCCGCTAAGCTCGAG -3'
(R):5'- GCCCGTCGCTCCACTACTAAG -3'

Posted On

2014-12-29