Incidental Mutation 'R2925:Nsf'
ID255715
Institutional Source Beutler Lab
Gene Symbol Nsf
Ensembl Gene ENSMUSG00000034187
Gene NameN-ethylmaleimide sensitive fusion protein
SynonymsSKD2, N-ethylmaleimide sensitive factor
MMRRC Submission 040510-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2925 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location103821782-103954056 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 103930752 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 26 (E26K)
Ref Sequence ENSEMBL: ENSMUSP00000099364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103075] [ENSMUST00000133774] [ENSMUST00000149642]
Predicted Effect possibly damaging
Transcript: ENSMUST00000103075
AA Change: E26K

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099364
Gene: ENSMUSG00000034187
AA Change: E26K

DomainStartEndE-ValueType
CDC48_N 5 86 2.7e-16 SMART
CDC48_2 111 183 6.22e-7 SMART
AAA 252 399 3.65e-19 SMART
AAA 535 671 2.2e-13 SMART
low complexity region 674 683 N/A INTRINSIC
low complexity region 698 711 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107009
Predicted Effect probably benign
Transcript: ENSMUST00000133774
SMART Domains Protein: ENSMUSP00000133591
Gene: ENSMUSG00000034187

DomainStartEndE-ValueType
Pfam:CDC48_N 1 51 1.5e-10 PFAM
CDC48_2 76 148 6.22e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140394
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145126
Predicted Effect possibly damaging
Transcript: ENSMUST00000149642
AA Change: E23K

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133603
Gene: ENSMUSG00000034187
AA Change: E23K

DomainStartEndE-ValueType
CDC48_N 2 76 6.51e-10 SMART
Meta Mutation Damage Score 0.0893 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 95% (40/42)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503E14Rik T C 14: 44,170,298 T93A probably damaging Het
4932438A13Rik G T 3: 37,007,122 A3327S probably damaging Het
9530003J23Rik C T 10: 117,234,431 R147Q probably benign Het
AI314180 T A 4: 58,833,928 K851* probably null Het
Akr1c21 A G 13: 4,576,350 probably null Het
Alk A G 17: 72,603,207 V168A probably benign Het
Ap4b1 A G 3: 103,820,681 E337G probably damaging Het
Btn2a2 A G 13: 23,481,814 S283P probably damaging Het
Ctcfl C T 2: 173,094,696 E628K probably damaging Het
Cul9 G A 17: 46,510,981 T1856M probably benign Het
Defb41 T C 1: 18,260,633 D30G probably damaging Het
Dnaic1 A T 4: 41,597,919 I74F probably damaging Het
Fbln2 T A 6: 91,265,855 C846S probably damaging Het
Fuom T C 7: 140,099,949 T110A probably benign Het
Gm498 A T 7: 143,883,999 R147* probably null Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Il12a TCAC TC 3: 68,697,987 probably null Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Man2b2 A G 5: 36,824,102 F224L probably benign Het
Mtbp G A 15: 55,619,814 R429Q probably benign Het
Ncapg2 C A 12: 116,438,729 T727K probably benign Het
Nek4 G A 14: 30,951,710 G29S probably benign Het
Nup214 A G 2: 31,998,003 K15E probably damaging Het
Olfr1029 T A 2: 85,975,781 C179* probably null Het
Olfr1079 C T 2: 86,538,547 D121N probably damaging Het
Olfr206 A T 16: 59,345,343 Y119* probably null Het
Olfr460 T A 6: 40,571,408 S7R probably benign Het
P2ry13 G A 3: 59,209,380 H326Y probably benign Het
Plec A G 15: 76,178,252 F2563S probably damaging Het
Rc3h1 A G 1: 160,954,976 Y675C probably damaging Het
Samd3 T A 10: 26,251,887 S288T probably benign Het
Scaf4 G T 16: 90,250,289 P400Q unknown Het
Selplg T C 5: 113,820,179 D22G possibly damaging Het
Slc30a6 T C 17: 74,402,004 probably benign Het
Syt3 T A 7: 44,395,798 V518E probably damaging Het
Tnks G A 8: 34,965,661 A2V unknown Het
Upk3a A G 15: 85,018,149 Y59C probably benign Het
Usp4 T C 9: 108,367,856 L331P probably damaging Het
Zbed5 A G 5: 129,903,198 T663A possibly damaging Het
Zbtb11 G A 16: 55,974,084 R8Q probably benign Het
Other mutations in Nsf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Nsf APN 11 103861885 splice site probably benign
IGL01377:Nsf APN 11 103872647 missense probably damaging 0.97
IGL01994:Nsf APN 11 103928782 missense probably damaging 0.98
IGL02141:Nsf APN 11 103828525 missense probably benign 0.02
IGL02663:Nsf APN 11 103930815 missense probably benign 0.04
IGL02871:Nsf APN 11 103862056 splice site probably benign
uhaul UTSW 11 103930752 missense possibly damaging 0.59
R0180:Nsf UTSW 11 103930780 missense probably damaging 1.00
R0880:Nsf UTSW 11 103913372 missense possibly damaging 0.72
R1146:Nsf UTSW 11 103828538 missense probably damaging 1.00
R1146:Nsf UTSW 11 103828538 missense probably damaging 1.00
R1203:Nsf UTSW 11 103926126 unclassified probably benign
R1873:Nsf UTSW 11 103859017 missense probably damaging 1.00
R1951:Nsf UTSW 11 103882876 nonsense probably null
R2163:Nsf UTSW 11 103863333 missense possibly damaging 0.64
R2193:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2194:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2287:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2289:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2343:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2345:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2346:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2347:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2350:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2405:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2406:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2407:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2408:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2409:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2411:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2435:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2924:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2987:Nsf UTSW 11 103859043 splice site probably null
R3177:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R3277:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R3741:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R3742:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R3845:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R4278:Nsf UTSW 11 103930806 missense probably damaging 0.96
R4717:Nsf UTSW 11 103823769 missense probably damaging 1.00
R4775:Nsf UTSW 11 103872593 missense possibly damaging 0.93
R4915:Nsf UTSW 11 103910359 unclassified probably benign
R4918:Nsf UTSW 11 103910359 unclassified probably benign
R5090:Nsf UTSW 11 103910578 missense probably benign 0.00
R5126:Nsf UTSW 11 103882792 nonsense probably null
R5411:Nsf UTSW 11 103882811 missense probably damaging 1.00
R5560:Nsf UTSW 11 103863255 missense possibly damaging 0.47
R6344:Nsf UTSW 11 103861904 missense probably damaging 1.00
R6596:Nsf UTSW 11 103910457 missense probably damaging 0.98
R7155:Nsf UTSW 11 103828530 nonsense probably null
R7272:Nsf UTSW 11 103827238 missense probably damaging 1.00
R7769:Nsf UTSW 11 103928839 missense probably damaging 1.00
X0066:Nsf UTSW 11 103823740 missense probably benign
Z1176:Nsf UTSW 11 103910554 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGGTTTGACAGTGTAATGACAG -3'
(R):5'- CTACCCTGGAGGAAGAAACACG -3'

Sequencing Primer
(F):5'- GTTTGACAGTGTAATGACAGAAATGC -3'
(R):5'- TCAGGATGGAGGGACATTTACTAC -3'
Posted On2014-12-29