Mutagenetix > Incidental Mutation

Incidental Mutation 'R2925:Hsp90aa1'

255717

Institutional Source

Beutler Lab

Gene Symbol

Hsp90aa1

Ensembl Gene

ENSMUSG00000021270

Gene Name

heat shock protein 90, alpha (cytosolic), class A member 1

Synonyms

hsp4, Hspca, Hsp90, Hsp86-1, Hsp89

MMRRC Submission

040510-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2925 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

110690605-110702728 bp(-) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

C to A at 110695681 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000118189 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021698] [ENSMUST00000094361] [ENSMUST00000124156] [ENSMUST00000149189] [ENSMUST00000155242]

AlphaFold

P07901

Predicted Effect

probably benign
Transcript: ENSMUST00000021698

SMART Domains

Protein: ENSMUSP00000021698
Gene: ENSMUSG00000021270

Domain	Start	End	E-Value	Type
HATPase_c	40	194	2.94e-11	SMART
Pfam:HSP90	196	733	6.7e-272	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000094361

SMART Domains

Protein: ENSMUSP00000091921
Gene: ENSMUSG00000021270

Domain	Start	End	E-Value	Type
HATPase_c	40	194	2.94e-11	SMART
Pfam:HSP90	196	728	2e-245	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000124156

SMART Domains

Protein: ENSMUSP00000121138
Gene: ENSMUSG00000021270

Domain	Start	End	E-Value	Type
PDB:3HHU\|B	1	103	1e-69	PDB
SCOP:d1byqa_	11	103	5e-48	SMART
Blast:HATPase_c	40	103	7e-39	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129005

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134967

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145255

Predicted Effect

probably null
Transcript: ENSMUST00000149189

SMART Domains

Protein: ENSMUSP00000114201
Gene: ENSMUSG00000021270

Domain	Start	End	E-Value	Type
PDB:3HHU\|B	1	98	6e-66	PDB
SCOP:d1byqa_	11	98	2e-45	SMART
Blast:HATPase_c	40	98	2e-35	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000155242

SMART Domains

Protein: ENSMUSP00000118189
Gene: ENSMUSG00000021270

Domain	Start	End	E-Value	Type
HATPase_c	40	194	2.94e-11	SMART

Meta Mutation Damage Score

0.9488

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

95% (40/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an inducible molecular chaperone that functions as a homodimer. The encoded protein aids in the proper folding of specific target proteins by use of an ATPase activity that is modulated by co-chaperones. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit male sterility associated with arrested male meiosis and male germ cell apoptosis. Mice homozygous for a transgenic gene disruption exhibit male sterility and small testis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503E14Rik	T	C	14: 44,170,298	T93A	probably damaging	Het
4932438A13Rik	G	T	3: 37,007,122	A3327S	probably damaging	Het
9530003J23Rik	C	T	10: 117,234,431	R147Q	probably benign	Het
AI314180	T	A	4: 58,833,928	K851*	probably null	Het
Akr1c21	A	G	13: 4,576,350		probably null	Het
Alk	A	G	17: 72,603,207	V168A	probably benign	Het
Ap4b1	A	G	3: 103,820,681	E337G	probably damaging	Het
Btn2a2	A	G	13: 23,481,814	S283P	probably damaging	Het
Ctcfl	C	T	2: 173,094,696	E628K	probably damaging	Het
Cul9	G	A	17: 46,510,981	T1856M	probably benign	Het
Defb41	T	C	1: 18,260,633	D30G	probably damaging	Het
Dnaic1	A	T	4: 41,597,919	I74F	probably damaging	Het
Fbln2	T	A	6: 91,265,855	C846S	probably damaging	Het
Fuom	T	C	7: 140,099,949	T110A	probably benign	Het
Gm498	A	T	7: 143,883,999	R147*	probably null	Het
Il12a	TCAC	TC	3: 68,697,987		probably null	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Man2b2	A	G	5: 36,824,102	F224L	probably benign	Het
Mtbp	G	A	15: 55,619,814	R429Q	probably benign	Het
Ncapg2	C	A	12: 116,438,729	T727K	probably benign	Het
Nek4	G	A	14: 30,951,710	G29S	probably benign	Het
Nsf	C	T	11: 103,930,752	E26K	possibly damaging	Het
Nup214	A	G	2: 31,998,003	K15E	probably damaging	Het
Olfr1029	T	A	2: 85,975,781	C179*	probably null	Het
Olfr1079	C	T	2: 86,538,547	D121N	probably damaging	Het
Olfr206	A	T	16: 59,345,343	Y119*	probably null	Het
Olfr460	T	A	6: 40,571,408	S7R	probably benign	Het
P2ry13	G	A	3: 59,209,380	H326Y	probably benign	Het
Plec	A	G	15: 76,178,252	F2563S	probably damaging	Het
Rc3h1	A	G	1: 160,954,976	Y675C	probably damaging	Het
Samd3	T	A	10: 26,251,887	S288T	probably benign	Het
Scaf4	G	T	16: 90,250,289	P400Q	unknown	Het
Selplg	T	C	5: 113,820,179	D22G	possibly damaging	Het
Slc30a6	T	C	17: 74,402,004		probably benign	Het
Syt3	T	A	7: 44,395,798	V518E	probably damaging	Het
Tnks	G	A	8: 34,965,661	A2V	unknown	Het
Upk3a	A	G	15: 85,018,149	Y59C	probably benign	Het
Usp4	T	C	9: 108,367,856	L331P	probably damaging	Het
Zbed5	A	G	5: 129,903,198	T663A	possibly damaging	Het
Zbtb11	G	A	16: 55,974,084	R8Q	probably benign	Het

Other mutations in Hsp90aa1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02056:Hsp90aa1	APN	12	110694015	unclassified	probably benign
IGL02243:Hsp90aa1	APN	12	110695091	missense	probably damaging	1.00
IGL02865:Hsp90aa1	APN	12	110693082	missense	probably benign	0.11
IGL02965:Hsp90aa1	APN	12	110695679	start codon destroyed	probably null	0.95
R0827:Hsp90aa1	UTSW	12	110692695	missense	probably benign	0.38
R1331:Hsp90aa1	UTSW	12	110692820	missense	probably damaging	1.00
R1498:Hsp90aa1	UTSW	12	110695688	splice site	probably null
R2039:Hsp90aa1	UTSW	12	110693782	missense	probably damaging	1.00
R2082:Hsp90aa1	UTSW	12	110692827	missense	probably damaging	1.00
R2102:Hsp90aa1	UTSW	12	110694132	missense	probably damaging	0.99
R2169:Hsp90aa1	UTSW	12	110692734	missense	probably damaging	0.99
R2194:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2194:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R2359:Hsp90aa1	UTSW	12	110694569	critical splice donor site	probably null
R2364:Hsp90aa1	UTSW	12	110692753	missense	probably damaging	0.99
R2393:Hsp90aa1	UTSW	12	110693406	missense	probably damaging	1.00
R2398:Hsp90aa1	UTSW	12	110692321	missense	possibly damaging	0.86
R2435:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2435:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R2924:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2924:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R2925:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3176:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3176:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3177:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3177:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3276:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3276:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3277:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3277:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3615:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3615:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3616:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3616:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R4033:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R4033:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R4815:Hsp90aa1	UTSW	12	110695226	missense	possibly damaging	0.45
R4932:Hsp90aa1	UTSW	12	110693717	missense	probably damaging	1.00
R5117:Hsp90aa1	UTSW	12	110695264	missense	possibly damaging	0.71
R5555:Hsp90aa1	UTSW	12	110692734	missense	probably damaging	1.00
R6382:Hsp90aa1	UTSW	12	110695517	critical splice donor site	probably null
R7024:Hsp90aa1	UTSW	12	110694112	missense	possibly damaging	0.46
R7324:Hsp90aa1	UTSW	12	110695225	missense	unknown
R7447:Hsp90aa1	UTSW	12	110692128	missense	possibly damaging	0.94
R7526:Hsp90aa1	UTSW	12	110695294	missense	unknown
R7732:Hsp90aa1	UTSW	12	110693418	missense	probably damaging	1.00
R8155:Hsp90aa1	UTSW	12	110695394	missense	unknown
R9004:Hsp90aa1	UTSW	12	110692611	missense	probably damaging	0.99
R9145:Hsp90aa1	UTSW	12	110696250	critical splice donor site	probably null
Z1177:Hsp90aa1	UTSW	12	110693466	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGGGAAAGCAACGTCCAATC -3'
(R):5'- GCACATGCGCTTCGTAATTACC -3'

Sequencing Primer
(F):5'- ATCCTCCAAGTGGTATACTCACG -3'
(R):5'- CGCATTCTGAAATGAGGTCATCC -3'

Posted On

2014-12-29