Incidental Mutation 'R2925:Hsp90aa1'
ID255717
Institutional Source Beutler Lab
Gene Symbol Hsp90aa1
Ensembl Gene ENSMUSG00000021270
Gene Nameheat shock protein 90, alpha (cytosolic), class A member 1
Synonymshsp4, Hspca, Hsp90, Hsp86-1, Hsp89
MMRRC Submission 040510-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2925 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location110690605-110702728 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) C to A at 110695681 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021698] [ENSMUST00000094361] [ENSMUST00000124156] [ENSMUST00000149189] [ENSMUST00000155242]
Predicted Effect probably benign
Transcript: ENSMUST00000021698
SMART Domains Protein: ENSMUSP00000021698
Gene: ENSMUSG00000021270

DomainStartEndE-ValueType
HATPase_c 40 194 2.94e-11 SMART
Pfam:HSP90 196 733 6.7e-272 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000094361
SMART Domains Protein: ENSMUSP00000091921
Gene: ENSMUSG00000021270

DomainStartEndE-ValueType
HATPase_c 40 194 2.94e-11 SMART
Pfam:HSP90 196 728 2e-245 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000124156
SMART Domains Protein: ENSMUSP00000121138
Gene: ENSMUSG00000021270

DomainStartEndE-ValueType
PDB:3HHU|B 1 103 1e-69 PDB
SCOP:d1byqa_ 11 103 5e-48 SMART
Blast:HATPase_c 40 103 7e-39 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145255
Predicted Effect probably null
Transcript: ENSMUST00000149189
SMART Domains Protein: ENSMUSP00000114201
Gene: ENSMUSG00000021270

DomainStartEndE-ValueType
PDB:3HHU|B 1 98 6e-66 PDB
SCOP:d1byqa_ 11 98 2e-45 SMART
Blast:HATPase_c 40 98 2e-35 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000155242
SMART Domains Protein: ENSMUSP00000118189
Gene: ENSMUSG00000021270

DomainStartEndE-ValueType
HATPase_c 40 194 2.94e-11 SMART
Meta Mutation Damage Score 0.9488 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an inducible molecular chaperone that functions as a homodimer. The encoded protein aids in the proper folding of specific target proteins by use of an ATPase activity that is modulated by co-chaperones. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit male sterility associated with arrested male meiosis and male germ cell apoptosis. Mice homozygous for a transgenic gene disruption exhibit male sterility and small testis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503E14Rik T C 14: 44,170,298 T93A probably damaging Het
4932438A13Rik G T 3: 37,007,122 A3327S probably damaging Het
9530003J23Rik C T 10: 117,234,431 R147Q probably benign Het
AI314180 T A 4: 58,833,928 K851* probably null Het
Akr1c21 A G 13: 4,576,350 probably null Het
Alk A G 17: 72,603,207 V168A probably benign Het
Ap4b1 A G 3: 103,820,681 E337G probably damaging Het
Btn2a2 A G 13: 23,481,814 S283P probably damaging Het
Ctcfl C T 2: 173,094,696 E628K probably damaging Het
Cul9 G A 17: 46,510,981 T1856M probably benign Het
Defb41 T C 1: 18,260,633 D30G probably damaging Het
Dnaic1 A T 4: 41,597,919 I74F probably damaging Het
Fbln2 T A 6: 91,265,855 C846S probably damaging Het
Fuom T C 7: 140,099,949 T110A probably benign Het
Gm498 A T 7: 143,883,999 R147* probably null Het
Il12a TCAC TC 3: 68,697,987 probably null Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Man2b2 A G 5: 36,824,102 F224L probably benign Het
Mtbp G A 15: 55,619,814 R429Q probably benign Het
Ncapg2 C A 12: 116,438,729 T727K probably benign Het
Nek4 G A 14: 30,951,710 G29S probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Nup214 A G 2: 31,998,003 K15E probably damaging Het
Olfr1029 T A 2: 85,975,781 C179* probably null Het
Olfr1079 C T 2: 86,538,547 D121N probably damaging Het
Olfr206 A T 16: 59,345,343 Y119* probably null Het
Olfr460 T A 6: 40,571,408 S7R probably benign Het
P2ry13 G A 3: 59,209,380 H326Y probably benign Het
Plec A G 15: 76,178,252 F2563S probably damaging Het
Rc3h1 A G 1: 160,954,976 Y675C probably damaging Het
Samd3 T A 10: 26,251,887 S288T probably benign Het
Scaf4 G T 16: 90,250,289 P400Q unknown Het
Selplg T C 5: 113,820,179 D22G possibly damaging Het
Slc30a6 T C 17: 74,402,004 probably benign Het
Syt3 T A 7: 44,395,798 V518E probably damaging Het
Tnks G A 8: 34,965,661 A2V unknown Het
Upk3a A G 15: 85,018,149 Y59C probably benign Het
Usp4 T C 9: 108,367,856 L331P probably damaging Het
Zbed5 A G 5: 129,903,198 T663A possibly damaging Het
Zbtb11 G A 16: 55,974,084 R8Q probably benign Het
Other mutations in Hsp90aa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02056:Hsp90aa1 APN 12 110694015 unclassified probably benign
IGL02243:Hsp90aa1 APN 12 110695091 missense probably damaging 1.00
IGL02865:Hsp90aa1 APN 12 110693082 missense probably benign 0.11
IGL02965:Hsp90aa1 APN 12 110695679 start codon destroyed probably null 0.95
R0827:Hsp90aa1 UTSW 12 110692695 missense probably benign 0.38
R1331:Hsp90aa1 UTSW 12 110692820 missense probably damaging 1.00
R1498:Hsp90aa1 UTSW 12 110695688 splice site probably null
R2039:Hsp90aa1 UTSW 12 110693782 missense probably damaging 1.00
R2082:Hsp90aa1 UTSW 12 110692827 missense probably damaging 1.00
R2102:Hsp90aa1 UTSW 12 110694132 missense probably damaging 0.99
R2169:Hsp90aa1 UTSW 12 110692734 missense probably damaging 0.99
R2194:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R2194:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R2359:Hsp90aa1 UTSW 12 110694569 critical splice donor site probably null
R2364:Hsp90aa1 UTSW 12 110692753 missense probably damaging 0.99
R2393:Hsp90aa1 UTSW 12 110693406 missense probably damaging 1.00
R2398:Hsp90aa1 UTSW 12 110692321 missense possibly damaging 0.86
R2435:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R2435:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R2924:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R2924:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R2925:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R3176:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R3176:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R3177:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R3177:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R3276:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R3276:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R3277:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R3277:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R3615:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R3615:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R3616:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R3616:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R4033:Hsp90aa1 UTSW 12 110695680 start codon destroyed possibly damaging 0.59
R4033:Hsp90aa1 UTSW 12 110695681 critical splice acceptor site probably null
R4815:Hsp90aa1 UTSW 12 110695226 missense possibly damaging 0.45
R4932:Hsp90aa1 UTSW 12 110693717 missense probably damaging 1.00
R5117:Hsp90aa1 UTSW 12 110695264 missense possibly damaging 0.71
R5555:Hsp90aa1 UTSW 12 110692734 missense probably damaging 1.00
R6382:Hsp90aa1 UTSW 12 110695517 critical splice donor site probably null
R7024:Hsp90aa1 UTSW 12 110694112 missense possibly damaging 0.46
R7324:Hsp90aa1 UTSW 12 110695225 missense unknown
R7447:Hsp90aa1 UTSW 12 110692128 missense possibly damaging 0.94
R7526:Hsp90aa1 UTSW 12 110695294 missense unknown
R7732:Hsp90aa1 UTSW 12 110693418 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGGAAAGCAACGTCCAATC -3'
(R):5'- GCACATGCGCTTCGTAATTACC -3'

Sequencing Primer
(F):5'- ATCCTCCAAGTGGTATACTCACG -3'
(R):5'- CGCATTCTGAAATGAGGTCATCC -3'
Posted On2014-12-29