Incidental Mutation 'R2926:Myt1'
ID255738
Institutional Source Beutler Lab
Gene Symbol Myt1
Ensembl Gene ENSMUSG00000010505
Gene Namemyelin transcription factor 1
SynonymsNZF-2a, NZF-2b, Nzf2, Nztf2
MMRRC Submission 040511-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2926 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location181763332-181827797 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 181826010 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 1079 (T1079M)
Ref Sequence ENSEMBL: ENSMUSP00000104388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081125] [ENSMUST00000108756] [ENSMUST00000108757]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081125
AA Change: T1159M

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000079900
Gene: ENSMUSG00000010505
AA Change: T1159M

DomainStartEndE-ValueType
Pfam:zf-C2HC 71 99 8.7e-16 PFAM
low complexity region 155 160 N/A INTRINSIC
low complexity region 185 201 N/A INTRINSIC
coiled coil region 300 354 N/A INTRINSIC
low complexity region 388 405 N/A INTRINSIC
Pfam:zf-C2HC 485 512 2.9e-14 PFAM
Pfam:zf-C2HC 529 557 4.3e-16 PFAM
Pfam:MYT1 604 660 2e-28 PFAM
Pfam:MYT1 659 835 2.3e-56 PFAM
Pfam:zf-C2HC 843 871 2e-18 PFAM
Pfam:zf-C2HC 887 915 1.9e-18 PFAM
Pfam:zf-C2HC 936 964 2.1e-16 PFAM
Pfam:zf-C2HC 989 1017 8.4e-16 PFAM
coiled coil region 1037 1109 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108756
AA Change: T1117M

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104387
Gene: ENSMUSG00000010505
AA Change: T1117M

DomainStartEndE-ValueType
Pfam:zf-C2HC 27 57 5.1e-18 PFAM
low complexity region 113 118 N/A INTRINSIC
low complexity region 143 159 N/A INTRINSIC
coiled coil region 258 312 N/A INTRINSIC
low complexity region 346 363 N/A INTRINSIC
Pfam:zf-C2HC 441 471 5e-17 PFAM
Pfam:zf-C2HC 485 515 3.1e-18 PFAM
Pfam:MYT1 562 618 2.4e-32 PFAM
Pfam:MYT1 617 794 2e-74 PFAM
Pfam:zf-C2HC 799 829 1.9e-19 PFAM
Pfam:zf-C2HC 843 873 9.7e-20 PFAM
Pfam:zf-C2HC 892 922 2.2e-18 PFAM
Pfam:zf-C2HC 945 975 1.7e-16 PFAM
coiled coil region 995 1067 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108757
AA Change: T1079M

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104388
Gene: ENSMUSG00000010505
AA Change: T1079M

DomainStartEndE-ValueType
Pfam:zf-C2HC 27 57 1e-17 PFAM
low complexity region 113 118 N/A INTRINSIC
low complexity region 143 159 N/A INTRINSIC
coiled coil region 258 312 N/A INTRINSIC
low complexity region 346 363 N/A INTRINSIC
Pfam:zf-C2HC 441 471 1e-16 PFAM
Pfam:zf-C2HC 485 510 6.2e-12 PFAM
Pfam:MYT1 524 580 2.7e-32 PFAM
Pfam:MYT1 579 756 2.3e-74 PFAM
Pfam:zf-C2HC 761 791 3.8e-19 PFAM
Pfam:zf-C2HC 805 835 1.9e-19 PFAM
Pfam:zf-C2HC 854 884 4.3e-18 PFAM
Pfam:zf-C2HC 907 937 3.3e-16 PFAM
coiled coil region 957 1029 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000129843
AA Change: T776M
SMART Domains Protein: ENSMUSP00000115697
Gene: ENSMUSG00000010505
AA Change: T776M

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
Pfam:zf-C2HC 147 174 6.2e-15 PFAM
Pfam:zf-C2HC 191 219 9.2e-17 PFAM
Pfam:MYT1 266 322 7.3e-29 PFAM
Pfam:MYT1 321 497 7.2e-57 PFAM
Pfam:zf-C2HC 505 533 9.6e-19 PFAM
Pfam:zf-C2HC 554 582 4.4e-17 PFAM
Pfam:zf-C2HC 607 635 1.8e-16 PFAM
coiled coil region 654 726 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130079
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148766
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: This gene is a member of the myelin transcription factor 1 gene family. The encoded protein, a zinc finger DNA-binding protein, is involved in regulation of oligodendrocyte differentiation and proliferation in the developing central nervous system. The gene product has a role in remyelination through regeneration of oligodendrocyte lineage cells in response to demyelination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die shortly after birth displaying improper diaphragm innervation and a failture to initiate breathing; mutant embryonic pancreata contain abnormal islet cells that express multiple hormones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 G T 5: 124,078,839 S438R possibly damaging Het
Add3 A G 19: 53,226,822 probably null Het
Adgrb2 T C 4: 130,008,344 L506P probably damaging Het
Atp6v0a1 A T 11: 101,043,948 I621L probably damaging Het
AV320801 G T X: 135,499,548 A96S possibly damaging Het
Calb1 T G 4: 15,904,302 L218R probably damaging Het
Ccdc162 G A 10: 41,561,207 probably benign Het
Ccser2 A T 14: 36,879,561 S842T possibly damaging Het
Cd300a A G 11: 114,893,313 E49G possibly damaging Het
Colec11 T A 12: 28,617,429 Q37L probably damaging Het
D630045J12Rik T A 6: 38,168,171 I1307F probably damaging Het
Dapk1 T C 13: 60,719,750 V257A possibly damaging Het
Dnah3 T A 7: 119,951,115 N3327I probably damaging Het
Gja8 C T 3: 96,919,153 V398I probably benign Het
Gm4450 A G 3: 98,450,556 probably benign Het
Hfm1 A T 5: 106,874,282 L179* probably null Het
Ift88 T C 14: 57,488,918 Y678H probably damaging Het
Itga10 A G 3: 96,652,849 N560D probably damaging Het
Itpk1 G T 12: 102,579,130 P238Q probably damaging Het
Kl T C 5: 150,953,341 W209R probably damaging Het
Lama4 A G 10: 39,078,832 N1127S probably benign Het
Lrp1 C T 10: 127,588,113 C830Y probably damaging Het
Mcmbp G A 7: 128,698,014 probably benign Het
Mrps33 A G 6: 39,805,504 S28P probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
N4bp1 A T 8: 86,861,796 Y171* probably null Het
Ncln G T 10: 81,488,438 T442K probably benign Het
Nphp4 T C 4: 152,518,139 V390A probably damaging Het
Ntrk2 C A 13: 59,060,284 T648K probably damaging Het
Nwd1 A G 8: 72,667,012 H301R probably damaging Het
Olfr729 A T 14: 50,148,436 V146E probably benign Het
Pcdh12 T C 18: 38,282,390 N561D probably damaging Het
Pcnx T A 12: 81,994,995 S2134T probably damaging Het
Ppp1cc G A 5: 122,174,088 A306T probably benign Het
Prrc2c C T 1: 162,706,127 probably benign Het
Rabggta C T 14: 55,719,290 R319H probably benign Het
Scn10a A C 9: 119,638,701 F791C possibly damaging Het
Stab1 T A 14: 31,161,799 D267V probably damaging Het
Sva A T 6: 42,042,662 Y152F possibly damaging Het
Tgfbrap1 T G 1: 43,075,629 M104L probably damaging Het
Tmed4 T C 11: 6,271,728 T203A probably benign Het
Toe1 C T 4: 116,804,980 A331T possibly damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trpm7 T C 2: 126,858,409 probably benign Het
Ttll7 C T 3: 146,930,415 R438* probably null Het
Usp11 G T X: 20,717,792 G601W probably damaging Het
Vmn2r112 A G 17: 22,615,003 T551A possibly damaging Het
Vmn2r73 T C 7: 85,871,663 K366E probably benign Het
Vps33a A G 5: 123,569,571 I111T possibly damaging Het
Other mutations in Myt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Myt1 APN 2 181801115 missense probably damaging 1.00
IGL00816:Myt1 APN 2 181807515 missense probably damaging 0.97
IGL01062:Myt1 APN 2 181797729 missense probably damaging 1.00
IGL01069:Myt1 APN 2 181825956 missense probably damaging 1.00
IGL01292:Myt1 APN 2 181805012 missense probably damaging 1.00
IGL01521:Myt1 APN 2 181825911 missense probably damaging 1.00
IGL01926:Myt1 APN 2 181821997 missense probably benign 0.00
IGL01976:Myt1 APN 2 181795739 missense probably damaging 1.00
IGL02066:Myt1 APN 2 181797189 missense probably damaging 1.00
IGL02109:Myt1 APN 2 181815617 splice site probably benign
IGL02209:Myt1 APN 2 181797234 missense probably benign 0.06
IGL02499:Myt1 APN 2 181825549 splice site probably benign
IGL03064:Myt1 APN 2 181797801 missense probably benign 0.31
IGL03394:Myt1 APN 2 181797845 missense probably damaging 1.00
PIT4366001:Myt1 UTSW 2 181825938 missense probably damaging 1.00
R0003:Myt1 UTSW 2 181801871 missense probably damaging 1.00
R0003:Myt1 UTSW 2 181801871 missense probably damaging 1.00
R0362:Myt1 UTSW 2 181763393 unclassified probably benign
R0627:Myt1 UTSW 2 181795689 missense probably benign 0.10
R0650:Myt1 UTSW 2 181782615 nonsense probably null
R0735:Myt1 UTSW 2 181807387 unclassified probably benign
R0744:Myt1 UTSW 2 181797505 intron probably benign
R1115:Myt1 UTSW 2 181811231 nonsense probably null
R1460:Myt1 UTSW 2 181802932 missense probably damaging 1.00
R1471:Myt1 UTSW 2 181797111 missense probably benign
R1836:Myt1 UTSW 2 181797275 missense probably benign
R1905:Myt1 UTSW 2 181797756 missense probably damaging 1.00
R2007:Myt1 UTSW 2 181795759 missense probably benign
R2040:Myt1 UTSW 2 181825924 missense probably damaging 1.00
R2140:Myt1 UTSW 2 181825979 missense probably damaging 1.00
R2323:Myt1 UTSW 2 181806557 missense probably damaging 1.00
R3895:Myt1 UTSW 2 181820070 missense probably damaging 1.00
R4093:Myt1 UTSW 2 181811398 missense probably damaging 1.00
R4649:Myt1 UTSW 2 181797414 missense probably benign
R4693:Myt1 UTSW 2 181795739 missense probably damaging 1.00
R4775:Myt1 UTSW 2 181822677 missense probably damaging 1.00
R4835:Myt1 UTSW 2 181797462 missense probably damaging 0.99
R5111:Myt1 UTSW 2 181795885 missense probably benign 0.01
R5120:Myt1 UTSW 2 181797620 missense probably benign 0.25
R5622:Myt1 UTSW 2 181797122 missense probably benign
R6457:Myt1 UTSW 2 181763425 splice site probably null
R6704:Myt1 UTSW 2 181811212 start codon destroyed probably null
R6752:Myt1 UTSW 2 181801082 missense probably damaging 1.00
R6944:Myt1 UTSW 2 181797594 missense possibly damaging 0.52
R7337:Myt1 UTSW 2 181802963 missense possibly damaging 0.71
R7362:Myt1 UTSW 2 181797240 missense probably benign 0.00
R7368:Myt1 UTSW 2 181782591 missense possibly damaging 0.53
R7385:Myt1 UTSW 2 181767705 intron probably null
R7411:Myt1 UTSW 2 181815106 missense probably damaging 1.00
R7593:Myt1 UTSW 2 181797739 missense possibly damaging 0.54
R7790:Myt1 UTSW 2 181797597 missense probably benign 0.00
R8035:Myt1 UTSW 2 181795739 missense probably damaging 1.00
R8156:Myt1 UTSW 2 181822761 critical splice donor site probably null
R8338:Myt1 UTSW 2 181801862 missense possibly damaging 0.94
RF006:Myt1 UTSW 2 181797773 missense probably damaging 1.00
Z1177:Myt1 UTSW 2 181797162 missense probably damaging 0.97
Z1177:Myt1 UTSW 2 181807602 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGACTGCTACTGTTGTCC -3'
(R):5'- GTCTTCATGCCTGGGCCTAATG -3'

Sequencing Primer
(F):5'- CCTGGGGTTAAGGCTTTCTCAC -3'
(R):5'- GAGGACATCATAGGAGACACTGATTC -3'
Posted On2014-12-29