Mutagenetix > Incidental Mutation

Incidental Mutation 'R2926:Itga10'

255740

Institutional Source

Beutler Lab

Gene Symbol

Itga10

Ensembl Gene

ENSMUSG00000090210

Gene Name

integrin, alpha 10

Synonyms

MMRRC Submission

040511-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.195) question?

Stock #

R2926 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

96645584-96664519 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 96652849 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 560 (N560D)

Ref Sequence

ENSEMBL: ENSMUSP00000112393 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029744] [ENSMUST00000119365] [ENSMUST00000137564]

AlphaFold

E9Q6R1

Predicted Effect

probably damaging
Transcript: ENSMUST00000029744
AA Change: N560D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029744
Gene: ENSMUSG00000090210
AA Change: N560D

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Int_alpha	37	93	9.03e-3	SMART
VWA	165	355	9.6e-43	SMART
Int_alpha	427	481	2.01e0	SMART
Int_alpha	482	539	5.14e-7	SMART
Int_alpha	545	600	5.34e-14	SMART
Int_alpha	607	652	8.75e0	SMART
transmembrane domain	1123	1145	N/A	INTRINSIC
low complexity region	1153	1166	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000119365
AA Change: N560D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112393
Gene: ENSMUSG00000090210
AA Change: N560D

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Int_alpha	37	93	9.03e-3	SMART
VWA	165	355	9.6e-43	SMART
Int_alpha	427	481	2.01e0	SMART
Int_alpha	482	539	5.14e-7	SMART
Int_alpha	545	600	5.34e-14	SMART
Int_alpha	607	652	8.75e0	SMART
transmembrane domain	1122	1144	N/A	INTRINSIC
low complexity region	1152	1165	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127607

Predicted Effect

probably benign
Transcript: ENSMUST00000137564

SMART Domains

Protein: ENSMUSP00000121011
Gene: ENSMUSG00000106447

Domain	Start	End	E-Value	Type
Pfam:PEX11	1	172	4.5e-57	PFAM
low complexity region	186	204	N/A	INTRINSIC
Int_alpha	222	278	9.03e-3	SMART
Blast:VWA	292	345	3e-7	BLAST

Meta Mutation Damage Score

0.2473

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.3%

Validation Efficiency

98% (50/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are integral transmembrane glycoproteins composed of noncovalently linked alpha and beta chains. They participate in cell adhesion as well as cell-surface mediated signalling. This gene encodes an integrin alpha chain and is expressed at high levels in chondrocytes, where it is transcriptionally regulated by AP-2epsilon and Ets-1. The protein encoded by this gene binds to collagen. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous null mice display slightly shortened long bones and amild abnormalities in ephysiseal plate morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb9	G	T	5: 124,078,839	S438R	possibly damaging	Het
Add3	A	G	19: 53,226,822		probably null	Het
Adgrb2	T	C	4: 130,008,344	L506P	probably damaging	Het
Atp6v0a1	A	T	11: 101,043,948	I621L	probably damaging	Het
AV320801	G	T	X: 135,499,548	A96S	possibly damaging	Het
Calb1	T	G	4: 15,904,302	L218R	probably damaging	Het
Ccdc162	G	A	10: 41,561,207		probably benign	Het
Ccser2	A	T	14: 36,879,561	S842T	possibly damaging	Het
Cd300a	A	G	11: 114,893,313	E49G	possibly damaging	Het
Colec11	T	A	12: 28,617,429	Q37L	probably damaging	Het
D630045J12Rik	T	A	6: 38,168,171	I1307F	probably damaging	Het
Dapk1	T	C	13: 60,719,750	V257A	possibly damaging	Het
Dnah3	T	A	7: 119,951,115	N3327I	probably damaging	Het
Gja8	C	T	3: 96,919,153	V398I	probably benign	Het
Gm4450	A	G	3: 98,450,556		probably benign	Het
Hfm1	A	T	5: 106,874,282	L179*	probably null	Het
Ift88	T	C	14: 57,488,918	Y678H	probably damaging	Het
Itpk1	G	T	12: 102,579,130	P238Q	probably damaging	Het
Kl	T	C	5: 150,953,341	W209R	probably damaging	Het
Lama4	A	G	10: 39,078,832	N1127S	probably benign	Het
Lrp1	C	T	10: 127,588,113	C830Y	probably damaging	Het
Mcmbp	G	A	7: 128,698,014		probably benign	Het
Mrps33	A	G	6: 39,805,504	S28P	probably damaging	Het
Myo9b	G	A	8: 71,334,337	R721Q	probably benign	Het
Myt1	C	T	2: 181,826,010	T1079M	possibly damaging	Het
N4bp1	A	T	8: 86,861,796	Y171*	probably null	Het
Ncln	G	T	10: 81,488,438	T442K	probably benign	Het
Nphp4	T	C	4: 152,518,139	V390A	probably damaging	Het
Ntrk2	C	A	13: 59,060,284	T648K	probably damaging	Het
Nwd1	A	G	8: 72,667,012	H301R	probably damaging	Het
Olfr729	A	T	14: 50,148,436	V146E	probably benign	Het
Pcdh12	T	C	18: 38,282,390	N561D	probably damaging	Het
Pcnx	T	A	12: 81,994,995	S2134T	probably damaging	Het
Ppp1cc	G	A	5: 122,174,088	A306T	probably benign	Het
Prrc2c	C	T	1: 162,706,127		probably benign	Het
Rabggta	C	T	14: 55,719,290	R319H	probably benign	Het
Scn10a	A	C	9: 119,638,701	F791C	possibly damaging	Het
Stab1	T	A	14: 31,161,799	D267V	probably damaging	Het
Sva	A	T	6: 42,042,662	Y152F	possibly damaging	Het
Tgfbrap1	T	G	1: 43,075,629	M104L	probably damaging	Het
Tmed4	T	C	11: 6,271,728	T203A	probably benign	Het
Toe1	C	T	4: 116,804,980	A331T	possibly damaging	Het
Trappc9	G	A	15: 73,025,967	R377W	probably damaging	Het
Trpm7	T	C	2: 126,858,409		probably benign	Het
Ttll7	C	T	3: 146,930,415	R438*	probably null	Het
Usp11	G	T	X: 20,717,792	G601W	probably damaging	Het
Vmn2r112	A	G	17: 22,615,003	T551A	possibly damaging	Het
Vmn2r73	T	C	7: 85,871,663	K366E	probably benign	Het
Vps33a	A	G	5: 123,569,571	I111T	possibly damaging	Het

Other mutations in Itga10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01473:Itga10	APN	3	96647641	missense	probably damaging	0.96
IGL01694:Itga10	APN	3	96652517	missense	probably damaging	0.99
IGL01754:Itga10	APN	3	96656775	unclassified	probably benign
IGL02527:Itga10	APN	3	96655624	unclassified	probably benign
IGL02956:Itga10	APN	3	96655113	missense	possibly damaging	0.46
IGL03371:Itga10	APN	3	96654788	missense	possibly damaging	0.84
IGL03055:Itga10	UTSW	3	96650520	missense	probably damaging	0.99
PIT4515001:Itga10	UTSW	3	96662632	missense	probably damaging	0.99
R0153:Itga10	UTSW	3	96653700	missense	probably benign	0.00
R0308:Itga10	UTSW	3	96651464	missense	probably damaging	1.00
R0331:Itga10	UTSW	3	96652483	missense	probably damaging	1.00
R0413:Itga10	UTSW	3	96649059	missense	probably damaging	1.00
R0437:Itga10	UTSW	3	96649137	missense	probably damaging	1.00
R0511:Itga10	UTSW	3	96658174	missense	probably damaging	1.00
R0630:Itga10	UTSW	3	96656299	unclassified	probably benign
R0844:Itga10	UTSW	3	96651738	splice site	probably benign
R0849:Itga10	UTSW	3	96652530	missense	possibly damaging	0.67
R0894:Itga10	UTSW	3	96653660	missense	possibly damaging	0.69
R0919:Itga10	UTSW	3	96651738	splice site	probably benign
R1027:Itga10	UTSW	3	96651738	splice site	probably benign
R1341:Itga10	UTSW	3	96652495	missense	probably damaging	1.00
R1350:Itga10	UTSW	3	96657477	missense	probably benign	0.01
R1370:Itga10	UTSW	3	96651738	splice site	probably benign
R1467:Itga10	UTSW	3	96652229	nonsense	probably null
R1467:Itga10	UTSW	3	96652229	nonsense	probably null
R1589:Itga10	UTSW	3	96651738	splice site	probably benign
R1590:Itga10	UTSW	3	96651738	splice site	probably benign
R1601:Itga10	UTSW	3	96653658	missense	possibly damaging	0.82
R1659:Itga10	UTSW	3	96662977	missense	probably damaging	0.96
R1665:Itga10	UTSW	3	96651738	splice site	probably benign
R1667:Itga10	UTSW	3	96651738	splice site	probably benign
R1686:Itga10	UTSW	3	96651825	missense	probably damaging	0.97
R1972:Itga10	UTSW	3	96651738	splice site	probably benign
R1976:Itga10	UTSW	3	96651738	splice site	probably benign
R2020:Itga10	UTSW	3	96652490	missense	probably damaging	1.00
R2040:Itga10	UTSW	3	96651738	splice site	probably benign
R2044:Itga10	UTSW	3	96651738	splice site	probably benign
R2044:Itga10	UTSW	3	96657690	missense	probably benign
R2045:Itga10	UTSW	3	96651738	splice site	probably benign
R2060:Itga10	UTSW	3	96654998	nonsense	probably null
R2146:Itga10	UTSW	3	96651492	missense	possibly damaging	0.59
R2146:Itga10	UTSW	3	96653723	missense	probably damaging	1.00
R2170:Itga10	UTSW	3	96650457	missense	probably damaging	1.00
R2893:Itga10	UTSW	3	96655100	missense	probably benign	0.11
R3622:Itga10	UTSW	3	96651738	splice site	probably benign
R3623:Itga10	UTSW	3	96651738	splice site	probably benign
R4416:Itga10	UTSW	3	96658246	missense	possibly damaging	0.58
R4633:Itga10	UTSW	3	96647704	missense	possibly damaging	0.92
R5074:Itga10	UTSW	3	96652211	nonsense	probably null
R5095:Itga10	UTSW	3	96648164	missense	probably benign	0.21
R5495:Itga10	UTSW	3	96647371	missense	possibly damaging	0.92
R5813:Itga10	UTSW	3	96652585	missense	probably benign	0.38
R6114:Itga10	UTSW	3	96649035	missense	probably damaging	1.00
R6172:Itga10	UTSW	3	96647437	missense	probably benign	0.18
R6275:Itga10	UTSW	3	96658185	missense	probably benign	0.36
R6298:Itga10	UTSW	3	96656762	missense	probably benign	0.00
R6433:Itga10	UTSW	3	96658041	critical splice donor site	probably null
R6841:Itga10	UTSW	3	96656714	missense	probably damaging	1.00
R6909:Itga10	UTSW	3	96662599	missense	probably benign	0.00
R6927:Itga10	UTSW	3	96656714	missense	probably damaging	1.00
R7124:Itga10	UTSW	3	96651765	missense	probably damaging	0.96
R7310:Itga10	UTSW	3	96648159	missense	probably damaging	1.00
R7387:Itga10	UTSW	3	96652778	missense	probably benign	0.11
R7464:Itga10	UTSW	3	96648155	missense	probably damaging	1.00
R7624:Itga10	UTSW	3	96652953	missense	probably benign
R7638:Itga10	UTSW	3	96657391	splice site	probably null
R7639:Itga10	UTSW	3	96649582	missense	probably benign	0.36
R7893:Itga10	UTSW	3	96649612	missense	probably damaging	1.00
R8297:Itga10	UTSW	3	96654800	missense	probably damaging	1.00
R8753:Itga10	UTSW	3	96651155	missense	probably damaging	1.00
R9526:Itga10	UTSW	3	96656957	missense	probably damaging	1.00
X0064:Itga10	UTSW	3	96652936	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GAGGCACACATATTTGAGAGCT -3'
(R):5'- CGGTTTTGCCTCATCCACCA -3'

Sequencing Primer
(F):5'- CACATATTTGAGAGCTTGCTAAGGG -3'
(R):5'- TTGGTCTGGAACTCACAGAGATC -3'

Posted On

2014-12-29