Mutagenetix > Incidental Mutation

Incidental Mutation 'R2926:Hfm1'

255750

Institutional Source

Beutler Lab

Gene Symbol

Hfm1

Ensembl Gene

ENSMUSG00000043410

Gene Name

HFM1, ATP-dependent DNA helicase homolog

Synonyms

LOC381663, A330009G12Rik, Mer3, Sec63d1

MMRRC Submission

040511-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.143) question?

Stock #

R2926 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

106840192-106926321 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 106874282 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 179 (L179*)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112690] [ENSMUST00000117588] [ENSMUST00000148495]

AlphaFold

D3Z4R1

Predicted Effect

probably null
Transcript: ENSMUST00000112690
AA Change: L966*

SMART Domains

Protein: ENSMUSP00000108310
Gene: ENSMUSG00000043410
AA Change: L966*

Domain	Start	End	E-Value	Type
DEXDc	276	490	3.66e-29	SMART
HELICc	571	657	1.56e-14	SMART
low complexity region	751	764	N/A	INTRINSIC
Sec63	775	1090	5.66e-60	SMART
Blast:Sec63	1130	1188	2e-18	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000117588
AA Change: L966*

SMART Domains

Protein: ENSMUSP00000112590
Gene: ENSMUSG00000043410
AA Change: L966*

Domain	Start	End	E-Value	Type
DEXDc	276	490	3.66e-29	SMART
HELICc	571	657	1.56e-14	SMART
low complexity region	751	764	N/A	INTRINSIC
Sec63	775	1090	5.66e-60	SMART
Blast:Sec63	1130	1188	2e-18	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000148495

Predicted Effect

probably null
Transcript: ENSMUST00000155171
AA Change: L179*

SMART Domains

Protein: ENSMUSP00000118674
Gene: ENSMUSG00000043410
AA Change: L179*

Domain	Start	End	E-Value	Type
low complexity region	9	22	N/A	INTRINSIC
Sec63	33	304	3.04e-42	SMART
Blast:Sec63	344	402	7e-19	BLAST

Meta Mutation Damage Score

0.9717

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.3%

Validation Efficiency

98% (50/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be an ATP-dependent DNA helicase and is expressed mainly in germ-line cells. Defects in this gene are a cause of premature ovarian failure 9 (POF9). [provided by RefSeq, Apr 2014]
PHENOTYPE: Meiosis ais disrupted in homozygotes and bothe sexes are sterile [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb9	G	T	5: 124,078,839	S438R	possibly damaging	Het
Add3	A	G	19: 53,226,822		probably null	Het
Adgrb2	T	C	4: 130,008,344	L506P	probably damaging	Het
Atp6v0a1	A	T	11: 101,043,948	I621L	probably damaging	Het
AV320801	G	T	X: 135,499,548	A96S	possibly damaging	Het
Calb1	T	G	4: 15,904,302	L218R	probably damaging	Het
Ccdc162	G	A	10: 41,561,207		probably benign	Het
Ccser2	A	T	14: 36,879,561	S842T	possibly damaging	Het
Cd300a	A	G	11: 114,893,313	E49G	possibly damaging	Het
Colec11	T	A	12: 28,617,429	Q37L	probably damaging	Het
D630045J12Rik	T	A	6: 38,168,171	I1307F	probably damaging	Het
Dapk1	T	C	13: 60,719,750	V257A	possibly damaging	Het
Dnah3	T	A	7: 119,951,115	N3327I	probably damaging	Het
Gja8	C	T	3: 96,919,153	V398I	probably benign	Het
Gm4450	A	G	3: 98,450,556		probably benign	Het
Ift88	T	C	14: 57,488,918	Y678H	probably damaging	Het
Itga10	A	G	3: 96,652,849	N560D	probably damaging	Het
Itpk1	G	T	12: 102,579,130	P238Q	probably damaging	Het
Kl	T	C	5: 150,953,341	W209R	probably damaging	Het
Lama4	A	G	10: 39,078,832	N1127S	probably benign	Het
Lrp1	C	T	10: 127,588,113	C830Y	probably damaging	Het
Mcmbp	G	A	7: 128,698,014		probably benign	Het
Mrps33	A	G	6: 39,805,504	S28P	probably damaging	Het
Myo9b	G	A	8: 71,334,337	R721Q	probably benign	Het
Myt1	C	T	2: 181,826,010	T1079M	possibly damaging	Het
N4bp1	A	T	8: 86,861,796	Y171*	probably null	Het
Ncln	G	T	10: 81,488,438	T442K	probably benign	Het
Nphp4	T	C	4: 152,518,139	V390A	probably damaging	Het
Ntrk2	C	A	13: 59,060,284	T648K	probably damaging	Het
Nwd1	A	G	8: 72,667,012	H301R	probably damaging	Het
Olfr729	A	T	14: 50,148,436	V146E	probably benign	Het
Pcdh12	T	C	18: 38,282,390	N561D	probably damaging	Het
Pcnx	T	A	12: 81,994,995	S2134T	probably damaging	Het
Ppp1cc	G	A	5: 122,174,088	A306T	probably benign	Het
Prrc2c	C	T	1: 162,706,127		probably benign	Het
Rabggta	C	T	14: 55,719,290	R319H	probably benign	Het
Scn10a	A	C	9: 119,638,701	F791C	possibly damaging	Het
Stab1	T	A	14: 31,161,799	D267V	probably damaging	Het
Sva	A	T	6: 42,042,662	Y152F	possibly damaging	Het
Tgfbrap1	T	G	1: 43,075,629	M104L	probably damaging	Het
Tmed4	T	C	11: 6,271,728	T203A	probably benign	Het
Toe1	C	T	4: 116,804,980	A331T	possibly damaging	Het
Trappc9	G	A	15: 73,025,967	R377W	probably damaging	Het
Trpm7	T	C	2: 126,858,409		probably benign	Het
Ttll7	C	T	3: 146,930,415	R438*	probably null	Het
Usp11	G	T	X: 20,717,792	G601W	probably damaging	Het
Vmn2r112	A	G	17: 22,615,003	T551A	possibly damaging	Het
Vmn2r73	T	C	7: 85,871,663	K366E	probably benign	Het
Vps33a	A	G	5: 123,569,571	I111T	possibly damaging	Het

Other mutations in Hfm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00944:Hfm1	APN	5	106902130	missense	possibly damaging	0.70
IGL01295:Hfm1	APN	5	106917606	missense	possibly damaging	0.46
IGL01725:Hfm1	APN	5	106917379	missense	probably benign	0.00
IGL01758:Hfm1	APN	5	106904793	missense	probably damaging	0.99
IGL01911:Hfm1	APN	5	106911544	missense	possibly damaging	0.92
IGL02337:Hfm1	APN	5	106904267	missense	possibly damaging	0.81
IGL02472:Hfm1	APN	5	106873928	splice site	probably benign
IGL02496:Hfm1	APN	5	106901761	missense	probably benign	0.00
IGL02545:Hfm1	APN	5	106895287	missense	probably damaging	1.00
IGL02584:Hfm1	APN	5	106878662	splice site	probably null
IGL02728:Hfm1	APN	5	106878823	missense	probably benign	0.13
IGL02881:Hfm1	APN	5	106874252	missense	probably damaging	1.00
IGL03108:Hfm1	APN	5	106895934	unclassified	probably benign
IGL03351:Hfm1	APN	5	106911575	nonsense	probably null
IGL03353:Hfm1	APN	5	106856929	missense	probably damaging	0.99
R0024:Hfm1	UTSW	5	106856924	missense	probably benign	0.41
R0024:Hfm1	UTSW	5	106856924	missense	probably benign	0.41
R0094:Hfm1	UTSW	5	106917478	missense	probably benign
R0633:Hfm1	UTSW	5	106917601	missense	possibly damaging	0.56
R0644:Hfm1	UTSW	5	106898256	critical splice donor site	probably null
R1078:Hfm1	UTSW	5	106878830	missense	probably damaging	1.00
R1120:Hfm1	UTSW	5	106904218	splice site	probably benign
R1166:Hfm1	UTSW	5	106911411	missense	probably benign	0.00
R1242:Hfm1	UTSW	5	106874901	missense	probably damaging	0.99
R1414:Hfm1	UTSW	5	106872353	missense	probably benign	0.01
R1450:Hfm1	UTSW	5	106918458	missense	probably damaging	0.99
R1529:Hfm1	UTSW	5	106853123	missense	probably benign	0.00
R1622:Hfm1	UTSW	5	106893523	missense	possibly damaging	0.58
R1710:Hfm1	UTSW	5	106880514	missense	probably damaging	1.00
R1710:Hfm1	UTSW	5	106896003	missense	probably damaging	0.96
R1757:Hfm1	UTSW	5	106880360	splice site	probably null
R1856:Hfm1	UTSW	5	106847676	missense	probably benign	0.00
R1984:Hfm1	UTSW	5	106898576	missense	probably damaging	0.98
R1985:Hfm1	UTSW	5	106898576	missense	probably damaging	0.98
R2040:Hfm1	UTSW	5	106901818	missense	probably damaging	1.00
R2122:Hfm1	UTSW	5	106896255	missense	probably damaging	1.00
R2426:Hfm1	UTSW	5	106847653	splice site	probably null
R2474:Hfm1	UTSW	5	106872416	missense	possibly damaging	0.81
R2944:Hfm1	UTSW	5	106872330	missense	probably damaging	1.00
R3705:Hfm1	UTSW	5	106892839	unclassified	probably benign
R4256:Hfm1	UTSW	5	106904797	missense	possibly damaging	0.83
R4455:Hfm1	UTSW	5	106886508	splice site	probably null
R4538:Hfm1	UTSW	5	106874890	missense	possibly damaging	0.47
R4540:Hfm1	UTSW	5	106874221	nonsense	probably null
R4591:Hfm1	UTSW	5	106847667	missense	probably benign	0.08
R4745:Hfm1	UTSW	5	106901843	missense	possibly damaging	0.87
R4747:Hfm1	UTSW	5	106917523	missense	probably benign
R4765:Hfm1	UTSW	5	106842539	missense	probably benign	0.21
R4821:Hfm1	UTSW	5	106854740	critical splice donor site	probably null
R4842:Hfm1	UTSW	5	106892751	missense	probably damaging	1.00
R4944:Hfm1	UTSW	5	106874213	missense	possibly damaging	0.46
R5093:Hfm1	UTSW	5	106901731	missense	probably damaging	1.00
R5399:Hfm1	UTSW	5	106917562	missense	possibly damaging	0.91
R5414:Hfm1	UTSW	5	106902076	missense	probably damaging	1.00
R5436:Hfm1	UTSW	5	106892772	missense	possibly damaging	0.61
R5459:Hfm1	UTSW	5	106904763	missense	probably damaging	1.00
R5485:Hfm1	UTSW	5	106847662	critical splice donor site	probably null
R5585:Hfm1	UTSW	5	106911439	missense	probably benign	0.05
R5631:Hfm1	UTSW	5	106904763	missense	probably damaging	1.00
R5705:Hfm1	UTSW	5	106911453	missense	probably benign	0.21
R5804:Hfm1	UTSW	5	106878589	splice site	probably null
R5959:Hfm1	UTSW	5	106874917	missense	probably damaging	1.00
R6046:Hfm1	UTSW	5	106898643	splice site	probably null
R6191:Hfm1	UTSW	5	106886553	missense	possibly damaging	0.95
R6345:Hfm1	UTSW	5	106841638	missense	probably benign
R6580:Hfm1	UTSW	5	106847709	missense	probably benign	0.00
R6651:Hfm1	UTSW	5	106847687	missense	probably benign	0.00
R6761:Hfm1	UTSW	5	106895279	missense	probably damaging	1.00
R6835:Hfm1	UTSW	5	106878815	nonsense	probably null
R6891:Hfm1	UTSW	5	106917374	missense	possibly damaging	0.49
R6924:Hfm1	UTSW	5	106850410	splice site	probably null
R6980:Hfm1	UTSW	5	106880477	missense	probably benign	0.31
R7054:Hfm1	UTSW	5	106896043	missense	probably benign	0.01
R7058:Hfm1	UTSW	5	106911440	missense	probably benign	0.04
R7189:Hfm1	UTSW	5	106901703	critical splice donor site	probably null
R7250:Hfm1	UTSW	5	106904331	missense	probably benign	0.00
R7376:Hfm1	UTSW	5	106895218	missense	possibly damaging	0.95
R7577:Hfm1	UTSW	5	106896043	missense	probably benign	0.01
R7636:Hfm1	UTSW	5	106917466	missense	probably benign	0.02
R7639:Hfm1	UTSW	5	106889925	missense	probably benign	0.03
R7639:Hfm1	UTSW	5	106898475	missense	possibly damaging	0.46
R7763:Hfm1	UTSW	5	106881861	missense	probably damaging	1.00
R7828:Hfm1	UTSW	5	106881791	critical splice donor site	probably null
R7905:Hfm1	UTSW	5	106898553	missense	probably damaging	1.00
R8160:Hfm1	UTSW	5	106896033	missense	probably null	0.00
R8477:Hfm1	UTSW	5	106881818	missense	probably benign	0.01
R8739:Hfm1	UTSW	5	106898505	missense	probably damaging	0.96
R8968:Hfm1	UTSW	5	106917573	missense	probably benign	0.00
R9072:Hfm1	UTSW	5	106898280	missense	probably benign	0.04
R9073:Hfm1	UTSW	5	106898280	missense	probably benign	0.04
R9152:Hfm1	UTSW	5	106841745	missense	probably benign	0.01
R9234:Hfm1	UTSW	5	106893468	missense	probably benign
R9244:Hfm1	UTSW	5	106874900	missense	probably damaging	0.96
R9576:Hfm1	UTSW	5	106874072	missense	probably benign	0.00
R9649:Hfm1	UTSW	5	106918463	missense	possibly damaging	0.82
R9743:Hfm1	UTSW	5	106874259	missense	possibly damaging	0.55
R9782:Hfm1	UTSW	5	106874030	missense	probably benign	0.38
R9789:Hfm1	UTSW	5	106917480	missense	probably benign	0.00
Z1177:Hfm1	UTSW	5	106871820	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCCTTGATATCACTGTATCTTGCAATC -3'
(R):5'- TCCAAACCCCAGTGTATAATGTC -3'

Sequencing Primer
(F):5'- TACGCCGCTGTAGTTGTA -3'
(R):5'- CTGAGGAATACACCCAGTGTTGATTG -3'

Posted On

2014-12-29