Mutagenetix > Incidental Mutation

Incidental Mutation 'R2926:Vps33a'

255752

Institutional Source

Beutler Lab

Gene Symbol

Vps33a

Ensembl Gene

ENSMUSG00000029434

Gene Name

VPS33A CORVET/HOPS core subunit

Synonyms

3830421M04Rik, bf

MMRRC Submission

040511-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2926 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

123528659-123573038 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 123569571 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 111 (I111T)

Ref Sequence

ENSEMBL: ENSMUSP00000031388 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031388]

AlphaFold

Q9D2N9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031388
AA Change: I111T

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000031388
Gene: ENSMUSG00000029434
AA Change: I111T

Domain	Start	End	E-Value	Type
low complexity region	12	27	N/A	INTRINSIC
Pfam:Sec1	34	592	7.2e-104	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000197467

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198900

Meta Mutation Damage Score

0.8888

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.3%

Validation Efficiency

98% (50/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene is a member of the Sec-1 domain family, and it encodes a protein similar to the yeast class C Vps33 protein. The mammalian class C VPS proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene produce hypopigmentation, an extended bleeeding time and abnormal kidney function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb9	G	T	5: 124,078,839	S438R	possibly damaging	Het
Add3	A	G	19: 53,226,822		probably null	Het
Adgrb2	T	C	4: 130,008,344	L506P	probably damaging	Het
Atp6v0a1	A	T	11: 101,043,948	I621L	probably damaging	Het
AV320801	G	T	X: 135,499,548	A96S	possibly damaging	Het
Calb1	T	G	4: 15,904,302	L218R	probably damaging	Het
Ccdc162	G	A	10: 41,561,207		probably benign	Het
Ccser2	A	T	14: 36,879,561	S842T	possibly damaging	Het
Cd300a	A	G	11: 114,893,313	E49G	possibly damaging	Het
Colec11	T	A	12: 28,617,429	Q37L	probably damaging	Het
D630045J12Rik	T	A	6: 38,168,171	I1307F	probably damaging	Het
Dapk1	T	C	13: 60,719,750	V257A	possibly damaging	Het
Dnah3	T	A	7: 119,951,115	N3327I	probably damaging	Het
Gja8	C	T	3: 96,919,153	V398I	probably benign	Het
Gm4450	A	G	3: 98,450,556		probably benign	Het
Hfm1	A	T	5: 106,874,282	L179*	probably null	Het
Ift88	T	C	14: 57,488,918	Y678H	probably damaging	Het
Itga10	A	G	3: 96,652,849	N560D	probably damaging	Het
Itpk1	G	T	12: 102,579,130	P238Q	probably damaging	Het
Kl	T	C	5: 150,953,341	W209R	probably damaging	Het
Lama4	A	G	10: 39,078,832	N1127S	probably benign	Het
Lrp1	C	T	10: 127,588,113	C830Y	probably damaging	Het
Mcmbp	G	A	7: 128,698,014		probably benign	Het
Mrps33	A	G	6: 39,805,504	S28P	probably damaging	Het
Myo9b	G	A	8: 71,334,337	R721Q	probably benign	Het
Myt1	C	T	2: 181,826,010	T1079M	possibly damaging	Het
N4bp1	A	T	8: 86,861,796	Y171*	probably null	Het
Ncln	G	T	10: 81,488,438	T442K	probably benign	Het
Nphp4	T	C	4: 152,518,139	V390A	probably damaging	Het
Ntrk2	C	A	13: 59,060,284	T648K	probably damaging	Het
Nwd1	A	G	8: 72,667,012	H301R	probably damaging	Het
Olfr729	A	T	14: 50,148,436	V146E	probably benign	Het
Pcdh12	T	C	18: 38,282,390	N561D	probably damaging	Het
Pcnx	T	A	12: 81,994,995	S2134T	probably damaging	Het
Ppp1cc	G	A	5: 122,174,088	A306T	probably benign	Het
Prrc2c	C	T	1: 162,706,127		probably benign	Het
Rabggta	C	T	14: 55,719,290	R319H	probably benign	Het
Scn10a	A	C	9: 119,638,701	F791C	possibly damaging	Het
Stab1	T	A	14: 31,161,799	D267V	probably damaging	Het
Sva	A	T	6: 42,042,662	Y152F	possibly damaging	Het
Tgfbrap1	T	G	1: 43,075,629	M104L	probably damaging	Het
Tmed4	T	C	11: 6,271,728	T203A	probably benign	Het
Toe1	C	T	4: 116,804,980	A331T	possibly damaging	Het
Trappc9	G	A	15: 73,025,967	R377W	probably damaging	Het
Trpm7	T	C	2: 126,858,409		probably benign	Het
Ttll7	C	T	3: 146,930,415	R438*	probably null	Het
Usp11	G	T	X: 20,717,792	G601W	probably damaging	Het
Vmn2r112	A	G	17: 22,615,003	T551A	possibly damaging	Het
Vmn2r73	T	C	7: 85,871,663	K366E	probably benign	Het

Other mutations in Vps33a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01345:Vps33a	APN	5	123572943	missense	probably benign	0.00
IGL01459:Vps33a	APN	5	123535308	missense	probably benign	0.08
IGL02473:Vps33a	APN	5	123569571	missense	probably damaging	1.00
IGL02899:Vps33a	APN	5	123531176	missense	probably damaging	1.00
R0498:Vps33a	UTSW	5	123570961	missense	probably benign	0.40
R1134:Vps33a	UTSW	5	123570912	missense	probably damaging	0.97
R1928:Vps33a	UTSW	5	123558621	missense	probably benign	0.02
R2012:Vps33a	UTSW	5	123531181	splice site	probably null
R3688:Vps33a	UTSW	5	123535211	splice site	probably null
R3872:Vps33a	UTSW	5	123531192	missense	probably benign	0.16
R4437:Vps33a	UTSW	5	123531884	missense	probably benign
R5153:Vps33a	UTSW	5	123558628	missense	probably damaging	1.00
R5396:Vps33a	UTSW	5	123558630	missense	probably damaging	0.98
R5686:Vps33a	UTSW	5	123547001	critical splice donor site	probably null
R5714:Vps33a	UTSW	5	123569500	missense	probably benign
R5814:Vps33a	UTSW	5	123565056	missense	probably damaging	1.00
R6845:Vps33a	UTSW	5	123535272	missense	probably benign	0.02
R7183:Vps33a	UTSW	5	123535215	missense	probably null	0.83
R7359:Vps33a	UTSW	5	123558633	missense	probably benign	0.00
R7593:Vps33a	UTSW	5	123536556	missense	probably benign	0.00
R7855:Vps33a	UTSW	5	123570979	missense	possibly damaging	0.78
R7885:Vps33a	UTSW	5	123535249	missense	possibly damaging	0.70
R8025:Vps33a	UTSW	5	123558675	missense	possibly damaging	0.76
R8139:Vps33a	UTSW	5	123533952	missense	probably benign	0.04
R8275:Vps33a	UTSW	5	123569459	missense	probably damaging	0.99
R8434:Vps33a	UTSW	5	123533881	missense	possibly damaging	0.74
R8845:Vps33a	UTSW	5	123571475	critical splice donor site	probably null
R8879:Vps33a	UTSW	5	123533899	missense	probably damaging	1.00
R8880:Vps33a	UTSW	5	123569443	missense	probably damaging	0.98
R9172:Vps33a	UTSW	5	123536541	missense	probably benign	0.17
R9440:Vps33a	UTSW	5	123564984	missense	probably damaging	1.00
R9502:Vps33a	UTSW	5	123558642	missense	probably benign	0.00
R9725:Vps33a	UTSW	5	123531072	missense	possibly damaging	0.95
X0026:Vps33a	UTSW	5	123547097	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- CAACAACATGGAAGTCTTCGG -3'
(R):5'- AACAATTTGGGTATGAGTGTCTGGC -3'

Sequencing Primer
(F):5'- ATCTCTGAGTTCCAGACTAGGCAG -3'
(R):5'- ATACCCTTGGGCCTGGAATTTAGAC -3'

Posted On

2014-12-29