Mutagenetix > Incidental Mutation

Incidental Mutation 'R2926:Atp6v0a1'

255772

Institutional Source

Beutler Lab

Gene Symbol

Atp6v0a1

Ensembl Gene

ENSMUSG00000019302

Gene Name

ATPase, H+ transporting, lysosomal V0 subunit A1

Synonyms

Atp6n1a, Vpp-1, Vpp1, V-ATPase a1, Atp6n1

MMRRC Submission

040511-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2926 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101009452-101063719 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 101043948 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 621 (I621L)

Ref Sequence

ENSEMBL: ENSMUSP00000099399 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044721] [ENSMUST00000092663] [ENSMUST00000103110] [ENSMUST00000168757]

AlphaFold

Q9Z1G4

Predicted Effect

probably benign
Transcript: ENSMUST00000044721
AA Change: I614L

PolyPhen 2 Score 0.274 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000044838
Gene: ENSMUSG00000019302
AA Change: I614L

Domain	Start	End	E-Value	Type
Pfam:V_ATPase_I	26	829	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000092663
AA Change: I614L

PolyPhen 2 Score 0.402 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000090333
Gene: ENSMUSG00000019302
AA Change: I614L

Domain	Start	End	E-Value	Type
Pfam:V_ATPase_I	26	823	N/A	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000103110
AA Change: I621L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000099399
Gene: ENSMUSG00000019302
AA Change: I621L

Domain	Start	End	E-Value	Type
Pfam:V_ATPase_I	27	829	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127810

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139857

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154896

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168757
AA Change: I614L

PolyPhen 2 Score 0.457 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000131848
Gene: ENSMUSG00000019302
AA Change: I614L

Domain	Start	End	E-Value	Type
Pfam:V_ATPase_I	26	829	N/A	PFAM

Meta Mutation Damage Score

0.6101

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.3%

Validation Efficiency

98% (50/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c", and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This gene encodes one of three A subunit proteins and the encoded protein is associated with clathrin-coated vesicles. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb9	G	T	5: 124,078,839	S438R	possibly damaging	Het
Add3	A	G	19: 53,226,822		probably null	Het
Adgrb2	T	C	4: 130,008,344	L506P	probably damaging	Het
AV320801	G	T	X: 135,499,548	A96S	possibly damaging	Het
Calb1	T	G	4: 15,904,302	L218R	probably damaging	Het
Ccdc162	G	A	10: 41,561,207		probably benign	Het
Ccser2	A	T	14: 36,879,561	S842T	possibly damaging	Het
Cd300a	A	G	11: 114,893,313	E49G	possibly damaging	Het
Colec11	T	A	12: 28,617,429	Q37L	probably damaging	Het
D630045J12Rik	T	A	6: 38,168,171	I1307F	probably damaging	Het
Dapk1	T	C	13: 60,719,750	V257A	possibly damaging	Het
Dnah3	T	A	7: 119,951,115	N3327I	probably damaging	Het
Gja8	C	T	3: 96,919,153	V398I	probably benign	Het
Gm4450	A	G	3: 98,450,556		probably benign	Het
Hfm1	A	T	5: 106,874,282	L179*	probably null	Het
Ift88	T	C	14: 57,488,918	Y678H	probably damaging	Het
Itga10	A	G	3: 96,652,849	N560D	probably damaging	Het
Itpk1	G	T	12: 102,579,130	P238Q	probably damaging	Het
Kl	T	C	5: 150,953,341	W209R	probably damaging	Het
Lama4	A	G	10: 39,078,832	N1127S	probably benign	Het
Lrp1	C	T	10: 127,588,113	C830Y	probably damaging	Het
Mcmbp	G	A	7: 128,698,014		probably benign	Het
Mrps33	A	G	6: 39,805,504	S28P	probably damaging	Het
Myo9b	G	A	8: 71,334,337	R721Q	probably benign	Het
Myt1	C	T	2: 181,826,010	T1079M	possibly damaging	Het
N4bp1	A	T	8: 86,861,796	Y171*	probably null	Het
Ncln	G	T	10: 81,488,438	T442K	probably benign	Het
Nphp4	T	C	4: 152,518,139	V390A	probably damaging	Het
Ntrk2	C	A	13: 59,060,284	T648K	probably damaging	Het
Nwd1	A	G	8: 72,667,012	H301R	probably damaging	Het
Olfr729	A	T	14: 50,148,436	V146E	probably benign	Het
Pcdh12	T	C	18: 38,282,390	N561D	probably damaging	Het
Pcnx	T	A	12: 81,994,995	S2134T	probably damaging	Het
Ppp1cc	G	A	5: 122,174,088	A306T	probably benign	Het
Prrc2c	C	T	1: 162,706,127		probably benign	Het
Rabggta	C	T	14: 55,719,290	R319H	probably benign	Het
Scn10a	A	C	9: 119,638,701	F791C	possibly damaging	Het
Stab1	T	A	14: 31,161,799	D267V	probably damaging	Het
Sva	A	T	6: 42,042,662	Y152F	possibly damaging	Het
Tgfbrap1	T	G	1: 43,075,629	M104L	probably damaging	Het
Tmed4	T	C	11: 6,271,728	T203A	probably benign	Het
Toe1	C	T	4: 116,804,980	A331T	possibly damaging	Het
Trappc9	G	A	15: 73,025,967	R377W	probably damaging	Het
Trpm7	T	C	2: 126,858,409		probably benign	Het
Ttll7	C	T	3: 146,930,415	R438*	probably null	Het
Usp11	G	T	X: 20,717,792	G601W	probably damaging	Het
Vmn2r112	A	G	17: 22,615,003	T551A	possibly damaging	Het
Vmn2r73	T	C	7: 85,871,663	K366E	probably benign	Het
Vps33a	A	G	5: 123,569,571	I111T	possibly damaging	Het

Other mutations in Atp6v0a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00687:Atp6v0a1	APN	11	101030505	critical splice donor site	probably null
IGL01024:Atp6v0a1	APN	11	101048439	missense	probably benign	0.00
IGL01390:Atp6v0a1	APN	11	101043802	missense	probably benign	0.01
IGL02214:Atp6v0a1	APN	11	101039840	missense	probably benign	0.01
IGL02639:Atp6v0a1	APN	11	101055518	missense	possibly damaging	0.90
R0125:Atp6v0a1	UTSW	11	101038851	splice site	probably null
R0193:Atp6v0a1	UTSW	11	101048482	missense	possibly damaging	0.90
R0265:Atp6v0a1	UTSW	11	101048515	missense	possibly damaging	0.80
R0973:Atp6v0a1	UTSW	11	101055491	nonsense	probably null
R0973:Atp6v0a1	UTSW	11	101055491	nonsense	probably null
R0974:Atp6v0a1	UTSW	11	101055491	nonsense	probably null
R1460:Atp6v0a1	UTSW	11	101033998	missense	probably damaging	1.00
R1580:Atp6v0a1	UTSW	11	101029204	missense	probably damaging	1.00
R1625:Atp6v0a1	UTSW	11	101055554	missense	probably damaging	1.00
R1644:Atp6v0a1	UTSW	11	101038786	missense	possibly damaging	0.65
R1779:Atp6v0a1	UTSW	11	101026685	missense	probably benign	0.01
R2895:Atp6v0a1	UTSW	11	101044598	missense	probably benign
R3727:Atp6v0a1	UTSW	11	101030420	missense	probably benign	0.01
R3943:Atp6v0a1	UTSW	11	101055517	missense	probably benign	0.00
R4820:Atp6v0a1	UTSW	11	101042950	missense	probably benign	0.00
R5119:Atp6v0a1	UTSW	11	101020515	missense	probably benign	0.02
R5250:Atp6v0a1	UTSW	11	101043044	missense	possibly damaging	0.94
R5377:Atp6v0a1	UTSW	11	101055587	missense	probably damaging	1.00
R5393:Atp6v0a1	UTSW	11	101038807	missense	possibly damaging	0.95
R5497:Atp6v0a1	UTSW	11	101029185	missense	probably damaging	1.00
R5787:Atp6v0a1	UTSW	11	101018574	missense	probably benign	0.04
R6054:Atp6v0a1	UTSW	11	101039889	missense	possibly damaging	0.91
R6076:Atp6v0a1	UTSW	11	101055060	missense	probably damaging	1.00
R6889:Atp6v0a1	UTSW	11	101029183	missense	possibly damaging	0.87
R7035:Atp6v0a1	UTSW	11	101027357	missense	probably damaging	0.97
R7084:Atp6v0a1	UTSW	11	101034042	missense	probably damaging	1.00
R7212:Atp6v0a1	UTSW	11	101043957	missense	probably benign	0.08
R8289:Atp6v0a1	UTSW	11	101034105	missense	probably damaging	1.00
R8461:Atp6v0a1	UTSW	11	101044574	missense	possibly damaging	0.60
R8680:Atp6v0a1	UTSW	11	101062403	makesense	probably null
R8725:Atp6v0a1	UTSW	11	101029189	missense	possibly damaging	0.94
R8727:Atp6v0a1	UTSW	11	101029189	missense	possibly damaging	0.94
R8935:Atp6v0a1	UTSW	11	101038693	missense	possibly damaging	0.90
R9658:Atp6v0a1	UTSW	11	101018588	missense	probably benign	0.18
R9762:Atp6v0a1	UTSW	11	101055601	missense	possibly damaging	0.46
R9779:Atp6v0a1	UTSW	11	101034112	missense	probably damaging	1.00
X0023:Atp6v0a1	UTSW	11	101044597	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- ATAGGCCTGTCGCTCTTAGTG -3'
(R):5'- AACTCTCCAGAGCTAAGAGGTATAG -3'

Sequencing Primer
(F):5'- GCCTGTCGCTCTTAGTGTCATTTC -3'
(R):5'- CCAGAGCTAAGAGGTATAGGGGGAG -3'

Posted On

2014-12-29