Mutagenetix > Incidental Mutations

Incidental Mutation 'R2926:Itpk1'

255776

Institutional Source

Beutler Lab

Gene Symbol

Itpk1

Ensembl Gene

ENSMUSG00000057963

Gene Name

inositol 1,3,4-triphosphate 5/6 kinase

Synonyms

MMRRC Submission

040511-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.926) question?

Stock #

R2926 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102568582-102704930 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 102579130 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Glutamine at position 238 (P238Q)

Ref Sequence

ENSEMBL: ENSMUSP00000046027 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046518]

Predicted Effect

probably damaging
Transcript: ENSMUST00000046518
AA Change: P238Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000046027
Gene: ENSMUSG00000057963
AA Change: P238Q

Domain	Start	End	E-Value	Type
Pfam:Ins134_P3_kin	1	318	2.8e-142	PFAM

Meta Mutation Damage Score

0.1469

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.3%

Validation Efficiency

98% (50/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that belongs to the inositol 1,3,4-trisphosphate 5/6-kinase family. This enzyme regulates the synthesis of inositol tetraphosphate, and downstream products, inositol pentakisphosphate and inositol hexakisphosphate. Inositol metabolism plays a role in the development of the neural tube. Disruptions in this gene are thought to be associated with neural tube defects. A pseudogene of this gene has been identified on chromosome X. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mice homozygous for a gene trap allele exhibit neural tube defects (exencephaly and spina bifida), growth retardation, kyphoscoliosis, and rib formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb9	G	T	5: 124,078,839	S438R	possibly damaging	Het
Add3	A	G	19: 53,226,822		probably null	Het
Adgrb2	T	C	4: 130,008,344	L506P	probably damaging	Het
Atp6v0a1	A	T	11: 101,043,948	I621L	probably damaging	Het
AV320801	G	T	X: 135,499,548	A96S	possibly damaging	Het
Calb1	T	G	4: 15,904,302	L218R	probably damaging	Het
Ccdc162	G	A	10: 41,561,207		probably benign	Het
Ccser2	A	T	14: 36,879,561	S842T	possibly damaging	Het
Cd300a	A	G	11: 114,893,313	E49G	possibly damaging	Het
Colec11	T	A	12: 28,617,429	Q37L	probably damaging	Het
D630045J12Rik	T	A	6: 38,168,171	I1307F	probably damaging	Het
Dapk1	T	C	13: 60,719,750	V257A	possibly damaging	Het
Dnah3	T	A	7: 119,951,115	N3327I	probably damaging	Het
Gja8	C	T	3: 96,919,153	V398I	probably benign	Het
Gm4450	A	G	3: 98,450,556		probably benign	Het
Hfm1	A	T	5: 106,874,282	L179*	probably null	Het
Ift88	T	C	14: 57,488,918	Y678H	probably damaging	Het
Itga10	A	G	3: 96,652,849	N560D	probably damaging	Het
Kl	T	C	5: 150,953,341	W209R	probably damaging	Het
Lama4	A	G	10: 39,078,832	N1127S	probably benign	Het
Lrp1	C	T	10: 127,588,113	C830Y	probably damaging	Het
Mcmbp	G	A	7: 128,698,014		probably benign	Het
Mrps33	A	G	6: 39,805,504	S28P	probably damaging	Het
Myo9b	G	A	8: 71,334,337	R721Q	probably benign	Het
Myt1	C	T	2: 181,826,010	T1079M	possibly damaging	Het
N4bp1	A	T	8: 86,861,796	Y171*	probably null	Het
Ncln	G	T	10: 81,488,438	T442K	probably benign	Het
Nphp4	T	C	4: 152,518,139	V390A	probably damaging	Het
Ntrk2	C	A	13: 59,060,284	T648K	probably damaging	Het
Nwd1	A	G	8: 72,667,012	H301R	probably damaging	Het
Olfr729	A	T	14: 50,148,436	V146E	probably benign	Het
Pcdh12	T	C	18: 38,282,390	N561D	probably damaging	Het
Pcnx	T	A	12: 81,994,995	S2134T	probably damaging	Het
Ppp1cc	G	A	5: 122,174,088	A306T	probably benign	Het
Prrc2c	C	T	1: 162,706,127		probably benign	Het
Rabggta	C	T	14: 55,719,290	R319H	probably benign	Het
Scn10a	A	C	9: 119,638,701	F791C	possibly damaging	Het
Stab1	T	A	14: 31,161,799	D267V	probably damaging	Het
Sva	A	T	6: 42,042,662	Y152F	possibly damaging	Het
Tgfbrap1	T	G	1: 43,075,629	M104L	probably damaging	Het
Tmed4	T	C	11: 6,271,728	T203A	probably benign	Het
Toe1	C	T	4: 116,804,980	A331T	possibly damaging	Het
Trappc9	G	A	15: 73,025,967	R377W	probably damaging	Het
Trpm7	T	C	2: 126,858,409		probably benign	Het
Ttll7	C	T	3: 146,930,415	R438*	probably null	Het
Usp11	G	T	X: 20,717,792	G601W	probably damaging	Het
Vmn2r112	A	G	17: 22,615,003	T551A	possibly damaging	Het
Vmn2r73	T	C	7: 85,871,663	K366E	probably benign	Het
Vps33a	A	G	5: 123,569,571	I111T	possibly damaging	Het

Other mutations in Itpk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01306:Itpk1	APN	12	102606103	missense	probably damaging	1.00
IGL02247:Itpk1	APN	12	102623409	missense	probably damaging	1.00
IGL02998:Itpk1	APN	12	102579139	missense	probably damaging	1.00
ANU23:Itpk1	UTSW	12	102606103	missense	probably damaging	1.00
R0432:Itpk1	UTSW	12	102606078	splice site	probably benign
R0622:Itpk1	UTSW	12	102573980	missense	probably damaging	1.00
R0659:Itpk1	UTSW	12	102606078	splice site	probably benign
R0835:Itpk1	UTSW	12	102675448	missense	probably damaging	1.00
R1171:Itpk1	UTSW	12	102606119	missense	probably damaging	1.00
R1812:Itpk1	UTSW	12	102574058	missense	probably benign	0.01
R1968:Itpk1	UTSW	12	102675470	splice site	probably null
R2277:Itpk1	UTSW	12	102570260	missense	probably benign
R4584:Itpk1	UTSW	12	102570157	missense	possibly damaging	0.89
R4690:Itpk1	UTSW	12	102606175	missense	probably damaging	0.96
R5050:Itpk1	UTSW	12	102704810	missense	probably damaging	1.00
R5326:Itpk1	UTSW	12	102573966	missense	possibly damaging	0.49
R5801:Itpk1	UTSW	12	102573945	missense	probably damaging	1.00
R5945:Itpk1	UTSW	12	102588553	missense	probably damaging	0.97
R7262:Itpk1	UTSW	12	102675453	missense	possibly damaging	0.89
R7421:Itpk1	UTSW	12	102574065	missense	possibly damaging	0.92
R7883:Itpk1	UTSW	12	102606175	missense	probably benign	0.35
R8438:Itpk1	UTSW	12	102606159	start gained	probably benign
X0058:Itpk1	UTSW	12	102574024	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCAAGCTGACTCACTGAAAG -3'
(R):5'- GACAAATTGAAGCCGGGATCC -3'

Sequencing Primer
(F):5'- ATTGTGTGGGCCCTTCTA -3'
(R):5'- CCTGATGGATGCACATCTCTATG -3'

Posted On

2014-12-29