Incidental Mutation 'R2926:Ntrk2'
ID255777
Institutional Source Beutler Lab
Gene Symbol Ntrk2
Ensembl Gene ENSMUSG00000055254
Gene Nameneurotrophic tyrosine kinase, receptor, type 2
SynonymsC030027L06Rik, Tkrb, trkB
MMRRC Submission 040511-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.908) question?
Stock #R2926 (G1)
Quality Score177
Status Validated
Chromosome13
Chromosomal Location58806569-59133970 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 59060284 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 648 (T648K)
Ref Sequence ENSEMBL: ENSMUSP00000153553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079828] [ENSMUST00000225488]
Predicted Effect probably damaging
Transcript: ENSMUST00000079828
AA Change: T648K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078757
Gene: ENSMUSG00000055254
AA Change: T648K

DomainStartEndE-ValueType
LRRNT 31 65 1.74e-4 SMART
LRRCT 148 195 8.56e-10 SMART
IGc2 209 273 4.43e-5 SMART
Pfam:I-set 298 377 1.2e-8 PFAM
transmembrane domain 431 453 N/A INTRINSIC
TyrKc 537 806 2.48e-142 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225244
Predicted Effect probably damaging
Transcript: ENSMUST00000225488
AA Change: T648K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.3777 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurotrophic tyrosine receptor kinase (NTRK) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Signalling through this kinase leads to cell differentiation. Mutations in this gene have been associated with obesity and mood disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Different lines of homozygous mice show varied abnormalities including innervation and neural defects, rod defects, impaired ovarian folliculogenesis, and reduced postnatal survival. Homozygotes for a point mutation are normal, but are subject to pharmacological control of signalling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 G T 5: 124,078,839 S438R possibly damaging Het
Add3 A G 19: 53,226,822 probably null Het
Adgrb2 T C 4: 130,008,344 L506P probably damaging Het
Atp6v0a1 A T 11: 101,043,948 I621L probably damaging Het
AV320801 G T X: 135,499,548 A96S possibly damaging Het
Calb1 T G 4: 15,904,302 L218R probably damaging Het
Ccdc162 G A 10: 41,561,207 probably benign Het
Ccser2 A T 14: 36,879,561 S842T possibly damaging Het
Cd300a A G 11: 114,893,313 E49G possibly damaging Het
Colec11 T A 12: 28,617,429 Q37L probably damaging Het
D630045J12Rik T A 6: 38,168,171 I1307F probably damaging Het
Dapk1 T C 13: 60,719,750 V257A possibly damaging Het
Dnah3 T A 7: 119,951,115 N3327I probably damaging Het
Gja8 C T 3: 96,919,153 V398I probably benign Het
Gm4450 A G 3: 98,450,556 probably benign Het
Hfm1 A T 5: 106,874,282 L179* probably null Het
Ift88 T C 14: 57,488,918 Y678H probably damaging Het
Itga10 A G 3: 96,652,849 N560D probably damaging Het
Itpk1 G T 12: 102,579,130 P238Q probably damaging Het
Kl T C 5: 150,953,341 W209R probably damaging Het
Lama4 A G 10: 39,078,832 N1127S probably benign Het
Lrp1 C T 10: 127,588,113 C830Y probably damaging Het
Mcmbp G A 7: 128,698,014 probably benign Het
Mrps33 A G 6: 39,805,504 S28P probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Myt1 C T 2: 181,826,010 T1079M possibly damaging Het
N4bp1 A T 8: 86,861,796 Y171* probably null Het
Ncln G T 10: 81,488,438 T442K probably benign Het
Nphp4 T C 4: 152,518,139 V390A probably damaging Het
Nwd1 A G 8: 72,667,012 H301R probably damaging Het
Olfr729 A T 14: 50,148,436 V146E probably benign Het
Pcdh12 T C 18: 38,282,390 N561D probably damaging Het
Pcnx T A 12: 81,994,995 S2134T probably damaging Het
Ppp1cc G A 5: 122,174,088 A306T probably benign Het
Prrc2c C T 1: 162,706,127 probably benign Het
Rabggta C T 14: 55,719,290 R319H probably benign Het
Scn10a A C 9: 119,638,701 F791C possibly damaging Het
Stab1 T A 14: 31,161,799 D267V probably damaging Het
Sva A T 6: 42,042,662 Y152F possibly damaging Het
Tgfbrap1 T G 1: 43,075,629 M104L probably damaging Het
Tmed4 T C 11: 6,271,728 T203A probably benign Het
Toe1 C T 4: 116,804,980 A331T possibly damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trpm7 T C 2: 126,858,409 probably benign Het
Ttll7 C T 3: 146,930,415 R438* probably null Het
Usp11 G T X: 20,717,792 G601W probably damaging Het
Vmn2r112 A G 17: 22,615,003 T551A possibly damaging Het
Vmn2r73 T C 7: 85,871,663 K366E probably benign Het
Vps33a A G 5: 123,569,571 I111T possibly damaging Het
Other mutations in Ntrk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01928:Ntrk2 APN 13 58846851 missense probably damaging 1.00
IGL02331:Ntrk2 APN 13 58846856 critical splice donor site probably null
IGL02465:Ntrk2 APN 13 59060380 missense probably damaging 1.00
PIT4366001:Ntrk2 UTSW 13 59060335 missense probably damaging 1.00
R0102:Ntrk2 UTSW 13 58808793 missense probably benign 0.00
R0547:Ntrk2 UTSW 13 58874370 missense probably damaging 0.99
R0615:Ntrk2 UTSW 13 59128186 nonsense probably null
R0620:Ntrk2 UTSW 13 58846821 missense probably benign
R1770:Ntrk2 UTSW 13 58861318 missense possibly damaging 0.67
R2063:Ntrk2 UTSW 13 58859297 missense probably damaging 1.00
R2089:Ntrk2 UTSW 13 58859301 missense possibly damaging 0.95
R2091:Ntrk2 UTSW 13 58859301 missense possibly damaging 0.95
R2091:Ntrk2 UTSW 13 58859301 missense possibly damaging 0.95
R2178:Ntrk2 UTSW 13 58808802 missense probably benign 0.06
R2275:Ntrk2 UTSW 13 58861351 missense probably damaging 1.00
R2370:Ntrk2 UTSW 13 59054434 missense probably benign 0.28
R2413:Ntrk2 UTSW 13 58874412 missense possibly damaging 0.56
R2520:Ntrk2 UTSW 13 59054276 intron probably null
R4163:Ntrk2 UTSW 13 58860240 missense probably damaging 1.00
R4320:Ntrk2 UTSW 13 58860146 missense possibly damaging 0.48
R4348:Ntrk2 UTSW 13 58878259 missense probably damaging 1.00
R4440:Ntrk2 UTSW 13 59060312 missense probably damaging 1.00
R4534:Ntrk2 UTSW 13 59126529 missense probably damaging 1.00
R4695:Ntrk2 UTSW 13 59126493 missense probably damaging 0.99
R5356:Ntrk2 UTSW 13 59060242 missense probably damaging 1.00
R5471:Ntrk2 UTSW 13 58871760 missense probably benign 0.01
R5750:Ntrk2 UTSW 13 58808922 missense probably benign 0.02
R5916:Ntrk2 UTSW 13 58808729 start codon destroyed probably null 0.98
R5972:Ntrk2 UTSW 13 58837819 missense probably damaging 1.00
R6015:Ntrk2 UTSW 13 59060395 missense probably damaging 1.00
R6298:Ntrk2 UTSW 13 58871756 nonsense probably null
R6419:Ntrk2 UTSW 13 58861299 nonsense probably null
R6488:Ntrk2 UTSW 13 58861356 missense possibly damaging 0.93
R6611:Ntrk2 UTSW 13 59054414 missense probably damaging 1.00
R6827:Ntrk2 UTSW 13 59126568 missense probably damaging 1.00
R6911:Ntrk2 UTSW 13 58859215 missense probably damaging 1.00
R7387:Ntrk2 UTSW 13 58985979 missense probably damaging 1.00
R7445:Ntrk2 UTSW 13 58846762 missense probably benign 0.03
R7561:Ntrk2 UTSW 13 58861388 missense probably benign 0.31
R8031:Ntrk2 UTSW 13 58874379 missense probably benign
R8044:Ntrk2 UTSW 13 59126499 missense probably damaging 1.00
Z1176:Ntrk2 UTSW 13 58874333 missense probably benign
Z1177:Ntrk2 UTSW 13 58859273 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGGTAGAAATGAGGCCGCTAG -3'
(R):5'- GCTACTCACCCGATAGTAGTCG -3'

Sequencing Primer
(F):5'- AGGCCGCTAGGTGCTTTC -3'
(R):5'- CGATAGTAGTCGGTGCTGTAC -3'
Posted On2014-12-29