Incidental Mutation 'R2926:Rabggta'
ID255781
Institutional Source Beutler Lab
Gene Symbol Rabggta
Ensembl Gene ENSMUSG00000040472
Gene NameRab geranylgeranyl transferase, a subunit
Synonyms
MMRRC Submission 040511-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R2926 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location55715416-55722263 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 55719290 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 319 (R319H)
Ref Sequence ENSEMBL: ENSMUSP00000154725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062861] [ENSMUST00000163889] [ENSMUST00000169237] [ENSMUST00000227061]
Predicted Effect probably benign
Transcript: ENSMUST00000062861
AA Change: R49H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000061498
Gene: ENSMUSG00000040472
AA Change: R49H

DomainStartEndE-ValueType
Pfam:PPTA 47 77 2.9e-8 PFAM
Pfam:PPTA 91 121 2e-12 PFAM
Pfam:PPTA 127 156 7.6e-11 PFAM
Pfam:PPTA 162 192 3.8e-12 PFAM
Pfam:PPTA 210 240 7.8e-12 PFAM
Pfam:RabGGT_insert 243 346 5.3e-47 PFAM
LRR 462 485 1.62e0 SMART
LRR 507 531 1.03e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163889
AA Change: R319H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000128668
Gene: ENSMUSG00000040472
AA Change: R319H

DomainStartEndE-ValueType
Pfam:PPTA 47 77 2.9e-8 PFAM
Pfam:PPTA 91 121 2e-12 PFAM
Pfam:PPTA 127 156 7.6e-11 PFAM
Pfam:PPTA 162 192 3.8e-12 PFAM
Pfam:PPTA 210 240 7.8e-12 PFAM
Pfam:RabGGT_insert 243 346 5.3e-47 PFAM
LRR 462 485 1.62e0 SMART
LRR 507 531 1.03e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169237
AA Change: R319H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000133032
Gene: ENSMUSG00000040472
AA Change: R319H

DomainStartEndE-ValueType
Pfam:PPTA 92 119 3.6e-12 PFAM
Pfam:PPTA 128 154 1.2e-10 PFAM
Pfam:PPTA 163 190 2e-11 PFAM
Pfam:PPTA 211 238 9e-12 PFAM
Pfam:RabGGT_insert 244 346 1.9e-46 PFAM
LRR 462 485 1.62e0 SMART
LRR 507 531 1.03e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226209
Predicted Effect probably benign
Transcript: ENSMUST00000227061
AA Change: R319H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227617
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228899
Meta Mutation Damage Score 0.0811 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 98% (50/51)
MGI Phenotype PHENOTYPE: Homozygotes exhibit diluted pigmentation, a platelet defect resulting in prolonged bleeding, macrothrombocytopenia, impaired killing by cytotoxic T lymphocytes, high mortality, and poor breeding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 G T 5: 124,078,839 S438R possibly damaging Het
Add3 A G 19: 53,226,822 probably null Het
Adgrb2 T C 4: 130,008,344 L506P probably damaging Het
Atp6v0a1 A T 11: 101,043,948 I621L probably damaging Het
AV320801 G T X: 135,499,548 A96S possibly damaging Het
Calb1 T G 4: 15,904,302 L218R probably damaging Het
Ccdc162 G A 10: 41,561,207 probably benign Het
Ccser2 A T 14: 36,879,561 S842T possibly damaging Het
Cd300a A G 11: 114,893,313 E49G possibly damaging Het
Colec11 T A 12: 28,617,429 Q37L probably damaging Het
D630045J12Rik T A 6: 38,168,171 I1307F probably damaging Het
Dapk1 T C 13: 60,719,750 V257A possibly damaging Het
Dnah3 T A 7: 119,951,115 N3327I probably damaging Het
Gja8 C T 3: 96,919,153 V398I probably benign Het
Gm4450 A G 3: 98,450,556 probably benign Het
Hfm1 A T 5: 106,874,282 L179* probably null Het
Ift88 T C 14: 57,488,918 Y678H probably damaging Het
Itga10 A G 3: 96,652,849 N560D probably damaging Het
Itpk1 G T 12: 102,579,130 P238Q probably damaging Het
Kl T C 5: 150,953,341 W209R probably damaging Het
Lama4 A G 10: 39,078,832 N1127S probably benign Het
Lrp1 C T 10: 127,588,113 C830Y probably damaging Het
Mcmbp G A 7: 128,698,014 probably benign Het
Mrps33 A G 6: 39,805,504 S28P probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Myt1 C T 2: 181,826,010 T1079M possibly damaging Het
N4bp1 A T 8: 86,861,796 Y171* probably null Het
Ncln G T 10: 81,488,438 T442K probably benign Het
Nphp4 T C 4: 152,518,139 V390A probably damaging Het
Ntrk2 C A 13: 59,060,284 T648K probably damaging Het
Nwd1 A G 8: 72,667,012 H301R probably damaging Het
Olfr729 A T 14: 50,148,436 V146E probably benign Het
Pcdh12 T C 18: 38,282,390 N561D probably damaging Het
Pcnx T A 12: 81,994,995 S2134T probably damaging Het
Ppp1cc G A 5: 122,174,088 A306T probably benign Het
Prrc2c C T 1: 162,706,127 probably benign Het
Scn10a A C 9: 119,638,701 F791C possibly damaging Het
Stab1 T A 14: 31,161,799 D267V probably damaging Het
Sva A T 6: 42,042,662 Y152F possibly damaging Het
Tgfbrap1 T G 1: 43,075,629 M104L probably damaging Het
Tmed4 T C 11: 6,271,728 T203A probably benign Het
Toe1 C T 4: 116,804,980 A331T possibly damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trpm7 T C 2: 126,858,409 probably benign Het
Ttll7 C T 3: 146,930,415 R438* probably null Het
Usp11 G T X: 20,717,792 G601W probably damaging Het
Vmn2r112 A G 17: 22,615,003 T551A possibly damaging Het
Vmn2r73 T C 7: 85,871,663 K366E probably benign Het
Vps33a A G 5: 123,569,571 I111T possibly damaging Het
Other mutations in Rabggta
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01876:Rabggta APN 14 55718671 missense probably damaging 0.98
IGL02263:Rabggta APN 14 55718961 splice site probably benign
IGL02293:Rabggta APN 14 55721696 missense probably benign 0.27
IGL02377:Rabggta APN 14 55718495 missense possibly damaging 0.66
IGL02901:Rabggta APN 14 55721681 missense probably benign 0.41
IGL03004:Rabggta APN 14 55719230 splice site probably benign
R0334:Rabggta UTSW 14 55720811 missense probably damaging 1.00
R1914:Rabggta UTSW 14 55721189 missense possibly damaging 0.73
R4469:Rabggta UTSW 14 55716487 missense probably benign 0.00
R5584:Rabggta UTSW 14 55720832 missense probably benign
R6721:Rabggta UTSW 14 55717203 missense probably damaging 1.00
R6960:Rabggta UTSW 14 55721842 critical splice donor site probably null
R7169:Rabggta UTSW 14 55720901 missense probably damaging 0.99
R7447:Rabggta UTSW 14 55719316 missense probably null 0.11
R7805:Rabggta UTSW 14 55719512 missense probably benign 0.00
R8038:Rabggta UTSW 14 55718930 missense probably benign 0.07
R8422:Rabggta UTSW 14 55718458 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- TCATCAGTGGCTGAGTCTCG -3'
(R):5'- ACCTTGCTACTCACGGTTGAC -3'

Sequencing Primer
(F):5'- AGTCTCGGCACCAGCACTC -3'
(R):5'- ACGAGGCACCTTTGAGTG -3'
Posted On2014-12-29