Incidental Mutation 'R2927:Ift22'
ID255794
Institutional Source Beutler Lab
Gene Symbol Ift22
Ensembl Gene ENSMUSG00000007987
Gene Nameintraflagellar transport 22
Synonyms3110017O03Rik, Rabl5
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2927 (G1)
Quality Score222
Status Not validated
Chromosome5
Chromosomal Location136908150-136915404 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136912945 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 147 (D147G)
Ref Sequence ENSEMBL: ENSMUSP00000143017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000199101] [ENSMUST00000200153] [ENSMUST00000200157]
Predicted Effect probably benign
Transcript: ENSMUST00000008131
SMART Domains Protein: ENSMUSP00000008131
Gene: ENSMUSG00000007987

DomainStartEndE-ValueType
Pfam:Arf 2 129 6.2e-10 PFAM
Pfam:SRPRB 2 182 9.9e-8 PFAM
Pfam:Ras 5 125 2.1e-13 PFAM
Pfam:Roc 5 125 3.2e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199101
AA Change: D147G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143017
Gene: ENSMUSG00000007987
AA Change: D147G

DomainStartEndE-ValueType
SCOP:d1f6ba_ 5 91 2e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200054
Predicted Effect probably benign
Transcript: ENSMUST00000200153
SMART Domains Protein: ENSMUSP00000142389
Gene: ENSMUSG00000007987

DomainStartEndE-ValueType
Pfam:Arf 2 133 1.1e-8 PFAM
Pfam:SRPRB 2 133 1.5e-5 PFAM
Pfam:Miro 5 122 7.9e-7 PFAM
Pfam:Ras 5 125 3.1e-12 PFAM
low complexity region 148 163 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200157
AA Change: D177G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143488
Gene: ENSMUSG00000007987
AA Change: D177G

DomainStartEndE-ValueType
Pfam:Arf 2 129 6.4e-10 PFAM
Pfam:SRPRB 2 181 1e-7 PFAM
Pfam:Miro 5 122 5.1e-8 PFAM
Pfam:Ras 5 125 1.9e-13 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Dsc2 T C 18: 20,045,501 Y282C probably damaging Het
Dsg1b C A 18: 20,405,251 P638Q probably benign Het
Eea1 C T 10: 96,013,358 S486L probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Igsf10 T A 3: 59,329,427 Q1111L probably benign Het
Ikzf1 T C 11: 11,769,324 Y344H probably damaging Het
Kif1c T A 11: 70,726,314 C813S probably benign Het
Krt16 A G 11: 100,248,799 L31P unknown Het
Lrrc49 G A 9: 60,593,746 R633* probably null Het
Mllt6 T A 11: 97,680,776 F1080I probably damaging Het
Olfr608 A G 7: 103,470,882 Y281C probably damaging Het
Plxnc1 T G 10: 94,793,292 probably null Het
Ppp4r2 T C 6: 100,861,465 Y115H probably damaging Het
Pramel1 T A 4: 143,398,818 D437E probably benign Het
Pstpip2 C A 18: 77,861,889 Q133K probably damaging Het
Ptgs2 A T 1: 150,101,260 T41S possibly damaging Het
Slc36a1 G A 11: 55,232,375 A389T probably damaging Het
Vav2 A G 2: 27,426,391 V30A probably damaging Het
Vmn1r119 C T 7: 21,012,131 V109I probably benign Het
Other mutations in Ift22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02153:Ift22 APN 5 136911696 missense probably benign 0.44
IGL02755:Ift22 APN 5 136911786 missense probably damaging 1.00
R0167:Ift22 UTSW 5 136911891 missense probably benign 0.05
R0556:Ift22 UTSW 5 136911291 splice site probably null
R1378:Ift22 UTSW 5 136912903 missense probably benign 0.09
R4058:Ift22 UTSW 5 136911863 missense unknown
R4562:Ift22 UTSW 5 136912870 missense probably benign 0.32
R4650:Ift22 UTSW 5 136911801 missense probably benign 0.40
R4957:Ift22 UTSW 5 136908216 start gained probably benign
R6057:Ift22 UTSW 5 136911133 missense possibly damaging 0.95
R7910:Ift22 UTSW 5 136911784 missense probably benign 0.00
R7991:Ift22 UTSW 5 136911784 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCTCATCCTTCACAAGCTAG -3'
(R):5'- TGCATGACAACTGAGACAGGC -3'

Sequencing Primer
(F):5'- CAAGCTAGAAAGTGTTCCTTGTCCAC -3'
(R):5'- GAGATAAGCGCTCCTATGCAGC -3'
Posted On2014-12-29