Incidental Mutation 'R2927:Mllt6'
ID 255805
Institutional Source Beutler Lab
Gene Symbol Mllt6
Ensembl Gene ENSMUSG00000038437
Gene Name myeloid/lymphoid or mixed-lineage leukemia; translocated to, 6
Synonyms Af17
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2927 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 97554240-97576289 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 97571602 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 1080 (F1080I)
Ref Sequence ENSEMBL: ENSMUSP00000103212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044730] [ENSMUST00000107586]
AlphaFold B1AR10
Predicted Effect possibly damaging
Transcript: ENSMUST00000044730
AA Change: F1050I

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000045445
Gene: ENSMUSG00000038437
AA Change: F1050I

DomainStartEndE-ValueType
PHD 7 55 5.92e-7 SMART
PHD 119 178 5e-5 SMART
low complexity region 190 224 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 290 330 N/A INTRINSIC
low complexity region 358 380 N/A INTRINSIC
low complexity region 398 412 N/A INTRINSIC
low complexity region 487 498 N/A INTRINSIC
low complexity region 502 516 N/A INTRINSIC
low complexity region 520 536 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
low complexity region 579 601 N/A INTRINSIC
low complexity region 649 666 N/A INTRINSIC
coiled coil region 703 744 N/A INTRINSIC
low complexity region 746 756 N/A INTRINSIC
low complexity region 773 782 N/A INTRINSIC
low complexity region 802 848 N/A INTRINSIC
low complexity region 860 901 N/A INTRINSIC
coiled coil region 915 942 N/A INTRINSIC
low complexity region 995 1018 N/A INTRINSIC
low complexity region 1026 1037 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107586
AA Change: F1080I

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103212
Gene: ENSMUSG00000038437
AA Change: F1080I

DomainStartEndE-ValueType
PHD 7 55 5.92e-7 SMART
PHD 119 178 5e-5 SMART
low complexity region 190 224 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 290 330 N/A INTRINSIC
low complexity region 336 356 N/A INTRINSIC
low complexity region 388 410 N/A INTRINSIC
low complexity region 428 442 N/A INTRINSIC
low complexity region 517 528 N/A INTRINSIC
low complexity region 532 546 N/A INTRINSIC
low complexity region 550 566 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
low complexity region 609 631 N/A INTRINSIC
low complexity region 679 696 N/A INTRINSIC
coiled coil region 733 774 N/A INTRINSIC
low complexity region 776 786 N/A INTRINSIC
low complexity region 803 812 N/A INTRINSIC
low complexity region 832 878 N/A INTRINSIC
low complexity region 890 931 N/A INTRINSIC
coiled coil region 945 972 N/A INTRINSIC
low complexity region 1025 1048 N/A INTRINSIC
low complexity region 1056 1067 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155835
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184494
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Dsc2 T C 18: 20,178,558 (GRCm39) Y282C probably damaging Het
Dsg1b C A 18: 20,538,308 (GRCm39) P638Q probably benign Het
Eea1 C T 10: 95,849,220 (GRCm39) S486L probably benign Het
Hspg2 C T 4: 137,246,251 (GRCm39) R1010C probably damaging Het
Ift22 A G 5: 136,941,799 (GRCm39) D147G probably damaging Het
Igsf10 T A 3: 59,236,848 (GRCm39) Q1111L probably benign Het
Ikzf1 T C 11: 11,719,324 (GRCm39) Y344H probably damaging Het
Kif1c T A 11: 70,617,140 (GRCm39) C813S probably benign Het
Krt16 A G 11: 100,139,625 (GRCm39) L31P unknown Het
Lrrc49 G A 9: 60,501,029 (GRCm39) R633* probably null Het
Or52ae7 A G 7: 103,120,089 (GRCm39) Y281C probably damaging Het
Plxnc1 T G 10: 94,629,154 (GRCm39) probably null Het
Ppp4r2 T C 6: 100,838,426 (GRCm39) Y115H probably damaging Het
Pramel1 T A 4: 143,125,388 (GRCm39) D437E probably benign Het
Pstpip2 C A 18: 77,949,589 (GRCm39) Q133K probably damaging Het
Ptgs2 A T 1: 149,977,011 (GRCm39) T41S possibly damaging Het
Slc36a1 G A 11: 55,123,201 (GRCm39) A389T probably damaging Het
Vav2 A G 2: 27,316,403 (GRCm39) V30A probably damaging Het
Vmn1r119 C T 7: 20,746,056 (GRCm39) V109I probably benign Het
Other mutations in Mllt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01745:Mllt6 APN 11 97,567,754 (GRCm39) missense probably damaging 1.00
IGL01808:Mllt6 APN 11 97,563,310 (GRCm39) missense possibly damaging 0.88
IGL01967:Mllt6 APN 11 97,565,603 (GRCm39) missense probably damaging 0.98
IGL02247:Mllt6 APN 11 97,561,158 (GRCm39) missense probably benign 0.01
IGL03161:Mllt6 APN 11 97,557,977 (GRCm39) missense probably benign 0.03
R0284:Mllt6 UTSW 11 97,569,431 (GRCm39) missense probably benign 0.02
R0718:Mllt6 UTSW 11 97,567,185 (GRCm39) splice site probably benign
R0783:Mllt6 UTSW 11 97,556,571 (GRCm39) missense probably damaging 0.99
R0811:Mllt6 UTSW 11 97,569,387 (GRCm39) missense probably damaging 0.97
R0812:Mllt6 UTSW 11 97,569,387 (GRCm39) missense probably damaging 0.97
R0904:Mllt6 UTSW 11 97,555,824 (GRCm39) missense probably damaging 1.00
R0960:Mllt6 UTSW 11 97,555,772 (GRCm39) splice site probably benign
R1445:Mllt6 UTSW 11 97,563,277 (GRCm39) splice site probably benign
R1523:Mllt6 UTSW 11 97,555,849 (GRCm39) missense probably damaging 1.00
R1781:Mllt6 UTSW 11 97,563,395 (GRCm39) missense probably benign
R1952:Mllt6 UTSW 11 97,568,048 (GRCm39) missense probably damaging 0.99
R2258:Mllt6 UTSW 11 97,555,802 (GRCm39) missense probably damaging 1.00
R2259:Mllt6 UTSW 11 97,555,802 (GRCm39) missense probably damaging 1.00
R4866:Mllt6 UTSW 11 97,565,285 (GRCm39) missense probably damaging 1.00
R4938:Mllt6 UTSW 11 97,569,233 (GRCm39) missense probably benign
R5039:Mllt6 UTSW 11 97,560,326 (GRCm39) missense possibly damaging 0.83
R5058:Mllt6 UTSW 11 97,560,326 (GRCm39) missense possibly damaging 0.83
R5064:Mllt6 UTSW 11 97,564,775 (GRCm39) missense probably damaging 1.00
R5076:Mllt6 UTSW 11 97,560,326 (GRCm39) missense possibly damaging 0.83
R5115:Mllt6 UTSW 11 97,560,326 (GRCm39) missense possibly damaging 0.83
R5379:Mllt6 UTSW 11 97,560,326 (GRCm39) missense possibly damaging 0.83
R5509:Mllt6 UTSW 11 97,560,326 (GRCm39) missense possibly damaging 0.83
R5510:Mllt6 UTSW 11 97,560,326 (GRCm39) missense possibly damaging 0.83
R5511:Mllt6 UTSW 11 97,560,326 (GRCm39) missense possibly damaging 0.83
R5603:Mllt6 UTSW 11 97,564,331 (GRCm39) missense probably damaging 1.00
R5816:Mllt6 UTSW 11 97,563,400 (GRCm39) missense probably damaging 0.97
R6030:Mllt6 UTSW 11 97,568,051 (GRCm39) missense probably damaging 0.99
R6030:Mllt6 UTSW 11 97,568,051 (GRCm39) missense probably damaging 0.99
R6051:Mllt6 UTSW 11 97,571,569 (GRCm39) nonsense probably null
R6180:Mllt6 UTSW 11 97,569,362 (GRCm39) missense possibly damaging 0.85
R6277:Mllt6 UTSW 11 97,564,774 (GRCm39) missense probably damaging 1.00
R6667:Mllt6 UTSW 11 97,567,760 (GRCm39) missense probably damaging 1.00
R6754:Mllt6 UTSW 11 97,565,273 (GRCm39) missense probably damaging 1.00
R6791:Mllt6 UTSW 11 97,571,428 (GRCm39) missense probably damaging 0.98
R7049:Mllt6 UTSW 11 97,564,637 (GRCm39) missense probably damaging 1.00
R7194:Mllt6 UTSW 11 97,564,394 (GRCm39) missense probably benign 0.23
R7387:Mllt6 UTSW 11 97,565,426 (GRCm39) missense probably benign 0.04
R7484:Mllt6 UTSW 11 97,563,442 (GRCm39) missense probably benign 0.18
R7685:Mllt6 UTSW 11 97,567,790 (GRCm39) missense probably damaging 0.99
R7853:Mllt6 UTSW 11 97,561,142 (GRCm39) missense probably benign
R7862:Mllt6 UTSW 11 97,556,631 (GRCm39) missense probably benign 0.03
R8004:Mllt6 UTSW 11 97,566,966 (GRCm39) missense possibly damaging 0.91
R8498:Mllt6 UTSW 11 97,567,688 (GRCm39) missense possibly damaging 0.86
R9044:Mllt6 UTSW 11 97,554,485 (GRCm39) missense probably damaging 1.00
R9297:Mllt6 UTSW 11 97,563,314 (GRCm39) missense probably damaging 0.96
R9457:Mllt6 UTSW 11 97,556,586 (GRCm39) missense probably benign 0.12
R9557:Mllt6 UTSW 11 97,564,310 (GRCm39) missense probably benign 0.04
Z1177:Mllt6 UTSW 11 97,567,251 (GRCm39) missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- AGTCTACTGGCTGGAAGCTC -3'
(R):5'- TACTGGAACCTGCTCAGTGG -3'

Sequencing Primer
(F):5'- TGGAAGCTCCACCCCACTG -3'
(R):5'- TCCTCTAGGGGGACACCAACAG -3'
Posted On 2014-12-29