Incidental Mutation 'R2943:Tor3a'
ID255812
Institutional Source Beutler Lab
Gene Symbol Tor3a
Ensembl Gene ENSMUSG00000060519
Gene Nametorsin family 3, member A
SynonymsAdir
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R2943 (G1)
Quality Score142
Status Not validated
Chromosome1
Chromosomal Location156653617-156674356 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 156674095 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 71 (P71S)
Ref Sequence ENSEMBL: ENSMUSP00000140129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079625] [ENSMUST00000086153] [ENSMUST00000122242] [ENSMUST00000122424] [ENSMUST00000150557] [ENSMUST00000156861] [ENSMUST00000188964] [ENSMUST00000190607]
Predicted Effect probably benign
Transcript: ENSMUST00000079625
AA Change: P71S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000078572
Gene: ENSMUSG00000060519
AA Change: P71S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Torsin 93 222 1.1e-60 PFAM
low complexity region 226 246 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086153
SMART Domains Protein: ENSMUSP00000083322
Gene: ENSMUSG00000033557

DomainStartEndE-ValueType
transmembrane domain 7 25 N/A INTRINSIC
Pfam:Fam20C 188 399 3.1e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122242
AA Change: P71S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000113984
Gene: ENSMUSG00000060519
AA Change: P71S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Torsin 93 222 1.1e-60 PFAM
low complexity region 226 246 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122424
SMART Domains Protein: ENSMUSP00000112534
Gene: ENSMUSG00000033557

DomainStartEndE-ValueType
transmembrane domain 7 25 N/A INTRINSIC
Pfam:DUF1193 187 402 2e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150557
AA Change: P71S

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000137828
Gene: ENSMUSG00000060519
AA Change: P71S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Torsin 93 206 2.3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156861
AA Change: P71S

PolyPhen 2 Score 0.376 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000140808
Gene: ENSMUSG00000060519
AA Change: P71S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188964
AA Change: P71S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000140079
Gene: ENSMUSG00000060519
AA Change: P71S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Torsin 93 222 1.1e-60 PFAM
low complexity region 226 246 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190607
AA Change: P71S

PolyPhen 2 Score 0.376 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000140129
Gene: ENSMUSG00000060519
AA Change: P71S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194858
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anln A G 9: 22,356,046 probably null Het
Aqp12 A T 1: 93,006,665 D88V probably damaging Het
Armc5 A C 7: 128,240,580 N357H probably damaging Het
Atad2b C A 12: 4,942,067 T222K probably damaging Het
Carmil2 C T 8: 105,692,932 H815Y probably benign Het
Chrna9 T C 5: 65,977,095 Y430H probably damaging Het
Eps8 T C 6: 137,522,872 D203G probably damaging Het
Galnt6 G T 15: 100,714,279 probably null Het
Gm5039 T C 12: 88,321,234 D83G probably benign Het
Gsdmc C T 15: 63,803,652 V105I possibly damaging Het
Kntc1 A G 5: 123,797,784 D1509G possibly damaging Het
Lrp10 C T 14: 54,469,845 probably benign Het
Mcmbp A T 7: 128,723,973 L97H probably damaging Het
Mfsd2a A G 4: 122,948,589 L495P possibly damaging Het
Olfr601 A G 7: 103,358,451 C248R probably damaging Het
Pank4 G A 4: 154,971,474 V319I probably benign Het
Pde7a T C 3: 19,230,325 N365D probably damaging Het
Pot1b A T 17: 55,674,058 S319T probably benign Het
Rbm25 T C 12: 83,660,641 I276T probably damaging Het
Reg1 T A 6: 78,428,145 L117Q possibly damaging Het
Ripor3 T C 2: 167,983,761 H759R possibly damaging Het
Rph3al A T 11: 75,834,888 probably null Het
S1pr4 A C 10: 81,498,872 L256R probably damaging Het
Sstr4 T C 2: 148,396,165 V232A probably damaging Het
Zfp804a C A 2: 82,235,879 Q65K probably damaging Het
Other mutations in Tor3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02173:Tor3a APN 1 156674206 missense probably benign 0.33
IGL03268:Tor3a APN 1 156669450 missense probably damaging 1.00
R3858:Tor3a UTSW 1 156669554 missense probably damaging 1.00
R4996:Tor3a UTSW 1 156655772 missense probably damaging 1.00
R5204:Tor3a UTSW 1 156655700 missense probably damaging 1.00
R5352:Tor3a UTSW 1 156674193 missense probably damaging 1.00
R5476:Tor3a UTSW 1 156673567 missense possibly damaging 0.94
R5653:Tor3a UTSW 1 156656510 missense probably damaging 1.00
R5931:Tor3a UTSW 1 156656487 missense probably benign 0.03
R6170:Tor3a UTSW 1 156656573 missense possibly damaging 0.89
R7674:Tor3a UTSW 1 156655908 missense possibly damaging 0.77
R8833:Tor3a UTSW 1 156655803 missense probably benign
Z1177:Tor3a UTSW 1 156674230 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- CAGAGCAGCCAGACCTTTAG -3'
(R):5'- AGGATGGGTTGCTCAGTCAG -3'

Sequencing Primer
(F):5'- AGAGCAGCCAGACCTTTAGTTGTC -3'
(R):5'- TCAGTCAGCCTCTGCGAG -3'
Posted On2014-12-29