Incidental Mutation 'R2943:Zfp804a'
ID255814
Institutional Source Beutler Lab
Gene Symbol Zfp804a
Ensembl Gene ENSMUSG00000070866
Gene Namezinc finger protein 804A
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.272) question?
Stock #R2943 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location82053222-82259879 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 82235879 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 65 (Q65K)
Ref Sequence ENSEMBL: ENSMUSP00000041941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047527]
Predicted Effect probably damaging
Transcript: ENSMUST00000047527
AA Change: Q65K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041941
Gene: ENSMUSG00000070866
AA Change: Q65K

DomainStartEndE-ValueType
ZnF_C2H2 57 81 7.29e0 SMART
low complexity region 588 595 N/A INTRINSIC
low complexity region 801 808 N/A INTRINSIC
low complexity region 1012 1029 N/A INTRINSIC
low complexity region 1061 1077 N/A INTRINSIC
low complexity region 1168 1191 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127187
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger binding protein. Polymorphisms in this gene, especially rs1344706, are thought to confer increased susceptibility to schizophrenia, bipolar disorder, and heroin addiciton. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anln A G 9: 22,356,046 probably null Het
Aqp12 A T 1: 93,006,665 D88V probably damaging Het
Armc5 A C 7: 128,240,580 N357H probably damaging Het
Atad2b C A 12: 4,942,067 T222K probably damaging Het
Carmil2 C T 8: 105,692,932 H815Y probably benign Het
Chrna9 T C 5: 65,977,095 Y430H probably damaging Het
Eps8 T C 6: 137,522,872 D203G probably damaging Het
Galnt6 G T 15: 100,714,279 probably null Het
Gm5039 T C 12: 88,321,234 D83G probably benign Het
Gsdmc C T 15: 63,803,652 V105I possibly damaging Het
Kntc1 A G 5: 123,797,784 D1509G possibly damaging Het
Lrp10 C T 14: 54,469,845 probably benign Het
Mcmbp A T 7: 128,723,973 L97H probably damaging Het
Mfsd2a A G 4: 122,948,589 L495P possibly damaging Het
Olfr601 A G 7: 103,358,451 C248R probably damaging Het
Pank4 G A 4: 154,971,474 V319I probably benign Het
Pde7a T C 3: 19,230,325 N365D probably damaging Het
Pot1b A T 17: 55,674,058 S319T probably benign Het
Rbm25 T C 12: 83,660,641 I276T probably damaging Het
Reg1 T A 6: 78,428,145 L117Q possibly damaging Het
Ripor3 T C 2: 167,983,761 H759R possibly damaging Het
Rph3al A T 11: 75,834,888 probably null Het
S1pr4 A C 10: 81,498,872 L256R probably damaging Het
Sstr4 T C 2: 148,396,165 V232A probably damaging Het
Tor3a G A 1: 156,674,095 P71S probably benign Het
Other mutations in Zfp804a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Zfp804a APN 2 82053875 missense probably benign 0.30
IGL02011:Zfp804a APN 2 82256691 missense probably damaging 1.00
IGL02218:Zfp804a APN 2 82259202 missense probably damaging 1.00
IGL02645:Zfp804a APN 2 82053876 missense possibly damaging 0.94
PIT4431001:Zfp804a UTSW 2 82259192 missense probably benign 0.04
R0027:Zfp804a UTSW 2 82257200 missense probably damaging 1.00
R0167:Zfp804a UTSW 2 82256516 missense probably damaging 1.00
R0437:Zfp804a UTSW 2 82053791 start codon destroyed probably null 0.08
R0521:Zfp804a UTSW 2 82259417 nonsense probably null
R0546:Zfp804a UTSW 2 82258920 missense possibly damaging 0.91
R0609:Zfp804a UTSW 2 82257588 missense probably damaging 1.00
R0694:Zfp804a UTSW 2 82053804 missense probably damaging 1.00
R0837:Zfp804a UTSW 2 82259162 missense probably damaging 1.00
R0947:Zfp804a UTSW 2 82258718 missense possibly damaging 0.58
R1103:Zfp804a UTSW 2 82257500 missense probably damaging 0.99
R1168:Zfp804a UTSW 2 82256697 missense probably benign 0.43
R1365:Zfp804a UTSW 2 82257246 missense probably benign 0.00
R1377:Zfp804a UTSW 2 82258497 missense probably benign 0.39
R1501:Zfp804a UTSW 2 82235799 missense probably damaging 1.00
R1526:Zfp804a UTSW 2 82258188 missense probably benign
R1585:Zfp804a UTSW 2 82053751 start gained probably benign
R1674:Zfp804a UTSW 2 82258824 missense probably benign 0.35
R2058:Zfp804a UTSW 2 82257366 missense probably benign 0.00
R2146:Zfp804a UTSW 2 82258664 missense probably benign 0.02
R2149:Zfp804a UTSW 2 82258664 missense probably benign 0.02
R2171:Zfp804a UTSW 2 82257183 missense possibly damaging 0.77
R2307:Zfp804a UTSW 2 82256857 missense probably benign 0.04
R2398:Zfp804a UTSW 2 82258669 missense possibly damaging 0.95
R2496:Zfp804a UTSW 2 82235844 missense probably damaging 1.00
R2504:Zfp804a UTSW 2 82257519 missense probably benign 0.00
R2919:Zfp804a UTSW 2 82235816 missense probably damaging 1.00
R3116:Zfp804a UTSW 2 82259417 missense probably damaging 1.00
R4170:Zfp804a UTSW 2 82253488 missense probably damaging 1.00
R4393:Zfp804a UTSW 2 82256921 missense probably benign 0.43
R4701:Zfp804a UTSW 2 82256582 missense probably damaging 1.00
R4771:Zfp804a UTSW 2 82257942 missense probably benign 0.01
R4793:Zfp804a UTSW 2 82235842 missense probably damaging 1.00
R5523:Zfp804a UTSW 2 82258995 missense probably damaging 1.00
R5526:Zfp804a UTSW 2 82258590 missense probably benign 0.00
R5961:Zfp804a UTSW 2 82258002 missense probably benign
R6181:Zfp804a UTSW 2 82257142 missense probably damaging 1.00
R6209:Zfp804a UTSW 2 82258118 missense probably damaging 1.00
R6325:Zfp804a UTSW 2 82257038 missense possibly damaging 0.80
R7147:Zfp804a UTSW 2 82258187 missense probably benign 0.00
R7229:Zfp804a UTSW 2 82258625 missense probably benign 0.04
R7666:Zfp804a UTSW 2 82259060 nonsense probably null
R7910:Zfp804a UTSW 2 82256573 missense probably damaging 1.00
R8256:Zfp804a UTSW 2 82053849 missense probably damaging 0.99
X0064:Zfp804a UTSW 2 82235823 missense probably damaging 1.00
Z1177:Zfp804a UTSW 2 82258563 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TCATGTTTTCAAACTTGTTTTGCTG -3'
(R):5'- ACTTGATTCATCATCACAGAATTACA -3'

Sequencing Primer
(F):5'- CTCAAGGGAGTGCTCATT -3'
(R):5'- GGTCTTAACAATTCAGTCCATG -3'
Posted On2014-12-29