Incidental Mutation 'R2943:Sstr4'
ID 255815
Institutional Source Beutler Lab
Gene Symbol Sstr4
Ensembl Gene ENSMUSG00000037014
Gene Name somatostatin receptor 4
Synonyms Smstr4, sst4
Accession Numbers
Essential gene? Probably non essential (E-score: 0.192) question?
Stock # R2943 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 148237297-148238684 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 148238085 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 232 (V232A)
Ref Sequence ENSEMBL: ENSMUSP00000105588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109962]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000109962
AA Change: V232A

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105588
Gene: ENSMUSG00000037014
AA Change: V232A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 55 323 4.7e-16 PFAM
Pfam:7tm_1 61 308 2.2e-61 PFAM
Pfam:7TM_GPCR_Srv 117 325 1.8e-10 PFAM
Pfam:7TM_GPCR_Srw 203 326 8.1e-9 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Somatostatin acts at many sites to inhibit the release of many hormones and other secretory proteins. The biologic effects of somatostatin are probably mediated by a family of G protein-coupled receptors that are expressed in a tissue-specific manner. SSTR4 is a member of the superfamily of receptors having seven transmembrane segments and is expressed in highest levels in fetal and adult brain and lung. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygote null mice have increased susceptibility to inflammation, delayed type hypersensitivity, hyperalgesia and airway hypersensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anln A G 9: 22,267,342 (GRCm39) probably null Het
Aqp12 A T 1: 92,934,387 (GRCm39) D88V probably damaging Het
Armc5 A C 7: 127,839,752 (GRCm39) N357H probably damaging Het
Atad2b C A 12: 4,992,067 (GRCm39) T222K probably damaging Het
Carmil2 C T 8: 106,419,564 (GRCm39) H815Y probably benign Het
Chrna9 T C 5: 66,134,438 (GRCm39) Y430H probably damaging Het
Eif1ad15 T C 12: 88,288,004 (GRCm39) D83G probably benign Het
Eps8 T C 6: 137,499,870 (GRCm39) D203G probably damaging Het
Galnt6 G T 15: 100,612,160 (GRCm39) probably null Het
Gsdmc C T 15: 63,675,501 (GRCm39) V105I possibly damaging Het
Kntc1 A G 5: 123,935,847 (GRCm39) D1509G possibly damaging Het
Lrp10 C T 14: 54,707,302 (GRCm39) probably benign Het
Mcmbp A T 7: 128,325,697 (GRCm39) L97H probably damaging Het
Mfsd2a A G 4: 122,842,382 (GRCm39) L495P possibly damaging Het
Or52s19 A G 7: 103,007,658 (GRCm39) C248R probably damaging Het
Pank4 G A 4: 155,055,931 (GRCm39) V319I probably benign Het
Pde7a T C 3: 19,284,489 (GRCm39) N365D probably damaging Het
Pot1b A T 17: 55,981,058 (GRCm39) S319T probably benign Het
Rbm25 T C 12: 83,707,415 (GRCm39) I276T probably damaging Het
Reg1 T A 6: 78,405,128 (GRCm39) L117Q possibly damaging Het
Ripor3 T C 2: 167,825,681 (GRCm39) H759R possibly damaging Het
Rph3al A T 11: 75,725,714 (GRCm39) probably null Het
S1pr4 A C 10: 81,334,706 (GRCm39) L256R probably damaging Het
Tor3a G A 1: 156,501,665 (GRCm39) P71S probably benign Het
Zfp804a C A 2: 82,066,223 (GRCm39) Q65K probably damaging Het
Other mutations in Sstr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Sstr4 APN 2 148,237,472 (GRCm39) missense probably benign 0.00
IGL01536:Sstr4 APN 2 148,237,800 (GRCm39) missense probably damaging 1.00
IGL02210:Sstr4 APN 2 148,238,229 (GRCm39) missense probably damaging 1.00
IGL02670:Sstr4 APN 2 148,238,453 (GRCm39) nonsense probably null
R0396:Sstr4 UTSW 2 148,238,181 (GRCm39) missense probably damaging 1.00
R1428:Sstr4 UTSW 2 148,238,279 (GRCm39) missense probably benign 0.01
R1839:Sstr4 UTSW 2 148,237,453 (GRCm39) missense probably benign 0.21
R2332:Sstr4 UTSW 2 148,238,330 (GRCm39) missense probably damaging 1.00
R3700:Sstr4 UTSW 2 148,238,273 (GRCm39) missense possibly damaging 0.57
R5502:Sstr4 UTSW 2 148,237,471 (GRCm39) small insertion probably benign
R5503:Sstr4 UTSW 2 148,237,471 (GRCm39) small insertion probably benign
R5596:Sstr4 UTSW 2 148,237,652 (GRCm39) missense possibly damaging 0.65
R5726:Sstr4 UTSW 2 148,238,003 (GRCm39) missense probably damaging 1.00
R6985:Sstr4 UTSW 2 148,238,169 (GRCm39) missense probably damaging 0.97
R8939:Sstr4 UTSW 2 148,238,228 (GRCm39) missense probably damaging 1.00
R8943:Sstr4 UTSW 2 148,237,782 (GRCm39) missense possibly damaging 0.94
X0022:Sstr4 UTSW 2 148,237,452 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGCCAAGCTAATCAACCTG -3'
(R):5'- ACATGGTTGACAGTGGCATC -3'

Sequencing Primer
(F):5'- CTAATCAACCTGGGAGTGTGGC -3'
(R):5'- TTGACAGTGGCATCGAGGC -3'
Posted On 2014-12-29