Incidental Mutation 'R0319:Atxn10'
ID25583
Institutional Source Beutler Lab
Gene Symbol Atxn10
Ensembl Gene ENSMUSG00000016541
Gene Nameataxin 10
SynonymsTEG-169, Sca10, E46, Tex169
MMRRC Submission 038529-MU
Accession Numbers

Genbank: NM_016843: MGI: 1859293

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0319 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location85336245-85463212 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85365282 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 105 (L105P)
Ref Sequence ENSEMBL: ENSMUSP00000132450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163242]
Predicted Effect probably damaging
Transcript: ENSMUST00000163242
AA Change: L105P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132450
Gene: ENSMUSG00000016541
AA Change: L105P

DomainStartEndE-ValueType
Pfam:Atx10homo_assoc 370 467 4.7e-38 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 95.0%
  • 20x: 89.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may function in neuron survival, neuron differentiation, and neuritogenesis. These roles may be carried out via activation of the mitogen-activated protein kinase cascade. Expansion of an ATTCT repeat from 9-32 copies to 800-4500 copies in an intronic region of this locus has been associated with spinocerebellar ataxia, type 10. Alternatively spliced transcript variants have been described.[provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mice die at early postimplantation stages. [provided by MGI curators]
Allele List at MGI

All alleles(20) : Gene trapped(20)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A C 7: 128,237,190 V77G probably benign Het
Abcb1b A G 5: 8,827,428 R663G probably benign Het
Acly A G 11: 100,504,982 V404A probably damaging Het
Actg2 T A 6: 83,520,743 I103F probably damaging Het
Anapc5 A G 5: 122,818,856 V120A probably damaging Het
Ankk1 T G 9: 49,416,071 T603P probably damaging Het
Ankmy2 T C 12: 36,165,899 S33P possibly damaging Het
Arhgef19 A T 4: 141,256,399 T748S possibly damaging Het
Atad5 T A 11: 80,120,790 probably benign Het
Cacna1s T C 1: 136,070,717 V161A probably damaging Het
Col6a3 T C 1: 90,807,704 E741G possibly damaging Het
Cpne9 G A 6: 113,294,693 G338E probably damaging Het
Cyp3a13 G A 5: 137,898,862 P397S probably damaging Het
Dbn1 C T 13: 55,474,916 E585K probably damaging Het
Dirc2 T C 16: 35,750,514 D140G probably benign Het
Draxin A G 4: 148,115,972 L7P probably benign Het
Exosc7 T A 9: 123,130,960 probably benign Het
Far2 A G 6: 148,157,470 E218G probably damaging Het
Ggps1 A C 13: 14,053,877 N240K possibly damaging Het
Kcnip1 T C 11: 33,651,529 probably benign Het
Kcnv2 A T 19: 27,324,024 Y425F probably benign Het
Kdelr2 T A 5: 143,412,517 F40I probably damaging Het
Kdm1b C T 13: 47,053,719 P173L probably benign Het
Kif20b G A 19: 34,947,732 probably benign Het
Klhl9 A T 4: 88,720,454 Y517N possibly damaging Het
Lgals3bp A G 11: 118,393,521 S411P probably damaging Het
Lmo3 G A 6: 138,377,311 T85M probably damaging Het
Lvrn C A 18: 46,864,753 T256N probably damaging Het
Malt1 T C 18: 65,462,915 probably null Het
Mgst1 A G 6: 138,156,157 I157V possibly damaging Het
Mob3a A T 10: 80,689,985 V164E possibly damaging Het
Mprip T A 11: 59,697,038 probably benign Het
Mst1 A G 9: 108,082,513 N276S probably benign Het
Olfr1437 A T 19: 12,322,316 C170* probably null Het
P3h2 T A 16: 25,970,931 I529F possibly damaging Het
Pikfyve T A 1: 65,246,331 S865T probably benign Het
Rcbtb2 G A 14: 73,178,469 R474Q probably benign Het
Rpl27 G A 11: 101,443,495 probably benign Het
Rtp1 G A 16: 23,431,460 E192K probably damaging Het
Sgk2 T C 2: 162,995,672 probably benign Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Spdl1 T C 11: 34,823,520 N114S possibly damaging Het
Syne2 C T 12: 76,064,162 R5756W probably damaging Het
Tor1aip1 T C 1: 156,007,181 E307G probably damaging Het
Tpd52 T C 3: 8,953,689 T44A probably benign Het
Trim67 A T 8: 124,823,227 Y532F probably damaging Het
Ttll9 C A 2: 153,000,098 probably null Het
Ush2a T C 1: 188,948,374 probably benign Het
Vcam1 T C 3: 116,116,060 I539M probably benign Het
Vmn1r19 T A 6: 57,404,615 M51K possibly damaging Het
Vmn2r61 T A 7: 42,300,517 M787K probably damaging Het
Xdh T A 17: 73,906,101 probably benign Het
Zfp109 A T 7: 24,234,470 V8E probably damaging Het
Zfp595 G A 13: 67,316,513 A562V possibly damaging Het
Zfp759 A G 13: 67,140,292 T636A probably benign Het
Other mutations in Atxn10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Atxn10 APN 15 85336465 start codon destroyed probably benign 0.33
IGL01020:Atxn10 APN 15 85375422 splice site probably null
IGL01380:Atxn10 APN 15 85376695 nonsense probably null
IGL01408:Atxn10 APN 15 85376695 nonsense probably null
3-1:Atxn10 UTSW 15 85438094 splice site probably benign
R0190:Atxn10 UTSW 15 85336529 missense possibly damaging 0.84
R1437:Atxn10 UTSW 15 85359474 missense possibly damaging 0.47
R1746:Atxn10 UTSW 15 85376663 missense probably damaging 1.00
R2050:Atxn10 UTSW 15 85365312 missense probably benign 0.37
R3055:Atxn10 UTSW 15 85387005 missense probably benign 0.03
R4559:Atxn10 UTSW 15 85438120 missense possibly damaging 0.81
R4786:Atxn10 UTSW 15 85387143 missense probably benign 0.03
R4799:Atxn10 UTSW 15 85376708 splice site probably null
R4831:Atxn10 UTSW 15 85387059 missense probably benign 0.01
R5323:Atxn10 UTSW 15 85391743 missense probably benign 0.00
R5335:Atxn10 UTSW 15 85336584 splice site probably null
R5355:Atxn10 UTSW 15 85462314 missense probably damaging 1.00
R5768:Atxn10 UTSW 15 85393420 missense probably benign 0.01
R6260:Atxn10 UTSW 15 85462411 missense probably benign 0.38
R6277:Atxn10 UTSW 15 85391692 missense probably benign 0.05
R6370:Atxn10 UTSW 15 85393385 missense probably damaging 1.00
R6645:Atxn10 UTSW 15 85376703 critical splice donor site probably null
R6957:Atxn10 UTSW 15 85336498 missense probably damaging 1.00
R7859:Atxn10 UTSW 15 85462325 missense probably benign 0.01
R8031:Atxn10 UTSW 15 85393393 missense probably benign
Predicted Primers PCR Primer
(F):5'- gcagaggatCACAGCACATGGAG -3'
(R):5'- GAAACTAGCAAGAGACAAGTCAGCCC -3'

Sequencing Primer
(F):5'- tctttgccttgccagttttc -3'
(R):5'- AGTCACAGCAACTTGCCTTC -3'
Posted On2013-04-16