Incidental Mutation 'R2943:Gsdmc'
ID255836
Institutional Source Beutler Lab
Gene Symbol Gsdmc
Ensembl Gene ENSMUSG00000079025
Gene Namegasdermin C
SynonymsMlze, Gsdmc1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R2943 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location63775968-63808759 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 63803652 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 105 (V105I)
Ref Sequence ENSEMBL: ENSMUSP00000105752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110125] [ENSMUST00000173503]
Predicted Effect possibly damaging
Transcript: ENSMUST00000110125
AA Change: V105I

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105752
Gene: ENSMUSG00000079025
AA Change: V105I

DomainStartEndE-ValueType
Pfam:Gasdermin 4 444 6.2e-170 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173503
AA Change: V105I

PolyPhen 2 Score 0.331 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000133683
Gene: ENSMUSG00000079025
AA Change: V105I

DomainStartEndE-ValueType
Pfam:Gasdermin 4 435 9.6e-157 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anln A G 9: 22,356,046 probably null Het
Aqp12 A T 1: 93,006,665 D88V probably damaging Het
Armc5 A C 7: 128,240,580 N357H probably damaging Het
Atad2b C A 12: 4,942,067 T222K probably damaging Het
Carmil2 C T 8: 105,692,932 H815Y probably benign Het
Chrna9 T C 5: 65,977,095 Y430H probably damaging Het
Eps8 T C 6: 137,522,872 D203G probably damaging Het
Galnt6 G T 15: 100,714,279 probably null Het
Gm5039 T C 12: 88,321,234 D83G probably benign Het
Kntc1 A G 5: 123,797,784 D1509G possibly damaging Het
Lrp10 C T 14: 54,469,845 probably benign Het
Mcmbp A T 7: 128,723,973 L97H probably damaging Het
Mfsd2a A G 4: 122,948,589 L495P possibly damaging Het
Olfr601 A G 7: 103,358,451 C248R probably damaging Het
Pank4 G A 4: 154,971,474 V319I probably benign Het
Pde7a T C 3: 19,230,325 N365D probably damaging Het
Pot1b A T 17: 55,674,058 S319T probably benign Het
Rbm25 T C 12: 83,660,641 I276T probably damaging Het
Reg1 T A 6: 78,428,145 L117Q possibly damaging Het
Ripor3 T C 2: 167,983,761 H759R possibly damaging Het
Rph3al A T 11: 75,834,888 probably null Het
S1pr4 A C 10: 81,498,872 L256R probably damaging Het
Sstr4 T C 2: 148,396,165 V232A probably damaging Het
Tor3a G A 1: 156,674,095 P71S probably benign Het
Zfp804a C A 2: 82,235,879 Q65K probably damaging Het
Other mutations in Gsdmc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Gsdmc APN 15 63804421 missense probably benign 0.41
IGL00791:Gsdmc APN 15 63804435 missense possibly damaging 0.85
IGL01889:Gsdmc APN 15 63780003 missense possibly damaging 0.89
IGL01917:Gsdmc APN 15 63778585 missense probably benign
IGL01948:Gsdmc APN 15 63778581 missense probably damaging 1.00
IGL02391:Gsdmc APN 15 63803579 missense probably damaging 0.99
IGL02479:Gsdmc APN 15 63777975 missense possibly damaging 0.87
IGL02551:Gsdmc APN 15 63801933 missense probably benign 0.00
R0115:Gsdmc UTSW 15 63803637 missense probably damaging 0.99
R1523:Gsdmc UTSW 15 63803630 missense probably damaging 0.99
R1655:Gsdmc UTSW 15 63780043 missense probably benign 0.42
R1990:Gsdmc UTSW 15 63801899 missense probably benign 0.12
R1991:Gsdmc UTSW 15 63801899 missense probably benign 0.12
R2267:Gsdmc UTSW 15 63776798 missense probably benign 0.12
R2882:Gsdmc UTSW 15 63779795 missense probably benign 0.24
R4110:Gsdmc UTSW 15 63780027 missense probably benign 0.08
R4712:Gsdmc UTSW 15 63779537 missense probably benign 0.01
R4963:Gsdmc UTSW 15 63804380 critical splice donor site probably null
R4997:Gsdmc UTSW 15 63776780 missense probably damaging 1.00
R5032:Gsdmc UTSW 15 63802033 missense possibly damaging 0.63
R5276:Gsdmc UTSW 15 63801957 missense probably benign 0.25
R5346:Gsdmc UTSW 15 63776886 missense probably damaging 1.00
R5963:Gsdmc UTSW 15 63780116 splice site probably null
R5965:Gsdmc UTSW 15 63804598 critical splice acceptor site probably null
R6872:Gsdmc UTSW 15 63778707 missense possibly damaging 0.79
R7035:Gsdmc UTSW 15 63778720 splice site probably null
R7408:Gsdmc UTSW 15 63804466 missense probably benign
R7719:Gsdmc UTSW 15 63778964 splice site probably null
R7862:Gsdmc UTSW 15 63777996 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- GCAACAGAACCTGCTTGCTG -3'
(R):5'- CCCTCTGTGGTAATTTACATTTCAG -3'

Sequencing Primer
(F):5'- TGCCTCTCTGCCTATAAGAACACAG -3'
(R):5'- CAGATATGGCTTATTAGCTAGCTTC -3'
Posted On2014-12-29