Incidental Mutation 'R2943:Pot1b'
ID255839
Institutional Source Beutler Lab
Gene Symbol Pot1b
Ensembl Gene ENSMUSG00000024174
Gene Nameprotection of telomeres 1B
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2943 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location55652025-55712628 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55674058 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 319 (S319T)
Ref Sequence ENSEMBL: ENSMUSP00000084089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086876]
Predicted Effect probably benign
Transcript: ENSMUST00000086876
AA Change: S319T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000084089
Gene: ENSMUSG00000024174
AA Change: S319T

DomainStartEndE-ValueType
Telo_bind 11 141 1.74e-51 SMART
Pfam:POT1PC 152 299 7.9e-40 PFAM
low complexity region 313 333 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for one null mutation display male infertility with age, male germ cell apoptosis, hyperpigmentation, increased apoptosis in intestinal crypts, and decreased body size. Mice homozygous for a transgenic gene disruption exhibit neonatal lethality with possible stem cell defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anln A G 9: 22,356,046 probably null Het
Aqp12 A T 1: 93,006,665 D88V probably damaging Het
Armc5 A C 7: 128,240,580 N357H probably damaging Het
Atad2b C A 12: 4,942,067 T222K probably damaging Het
Carmil2 C T 8: 105,692,932 H815Y probably benign Het
Chrna9 T C 5: 65,977,095 Y430H probably damaging Het
Eps8 T C 6: 137,522,872 D203G probably damaging Het
Galnt6 G T 15: 100,714,279 probably null Het
Gm5039 T C 12: 88,321,234 D83G probably benign Het
Gsdmc C T 15: 63,803,652 V105I possibly damaging Het
Kntc1 A G 5: 123,797,784 D1509G possibly damaging Het
Lrp10 C T 14: 54,469,845 probably benign Het
Mcmbp A T 7: 128,723,973 L97H probably damaging Het
Mfsd2a A G 4: 122,948,589 L495P possibly damaging Het
Olfr601 A G 7: 103,358,451 C248R probably damaging Het
Pank4 G A 4: 154,971,474 V319I probably benign Het
Pde7a T C 3: 19,230,325 N365D probably damaging Het
Rbm25 T C 12: 83,660,641 I276T probably damaging Het
Reg1 T A 6: 78,428,145 L117Q possibly damaging Het
Ripor3 T C 2: 167,983,761 H759R possibly damaging Het
Rph3al A T 11: 75,834,888 probably null Het
S1pr4 A C 10: 81,498,872 L256R probably damaging Het
Sstr4 T C 2: 148,396,165 V232A probably damaging Het
Tor3a G A 1: 156,674,095 P71S probably benign Het
Zfp804a C A 2: 82,235,879 Q65K probably damaging Het
Other mutations in Pot1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01484:Pot1b APN 17 55695160 missense possibly damaging 0.94
IGL01796:Pot1b APN 17 55669750 missense possibly damaging 0.53
IGL01810:Pot1b APN 17 55662521 missense possibly damaging 0.68
IGL02371:Pot1b APN 17 55695092 missense possibly damaging 0.91
IGL02553:Pot1b APN 17 55695024 splice site probably benign
IGL02957:Pot1b APN 17 55700009 missense probably damaging 0.99
IGL02975:Pot1b APN 17 55662454 splice site probably benign
IGL03172:Pot1b APN 17 55695206 missense possibly damaging 0.60
boulder UTSW 17 55672865 nonsense probably null
erosion UTSW 17 55687834 missense probably damaging 0.99
R0020:Pot1b UTSW 17 55653429 missense probably benign 0.03
R0540:Pot1b UTSW 17 55665765 missense probably damaging 0.98
R0607:Pot1b UTSW 17 55665765 missense probably damaging 0.98
R0882:Pot1b UTSW 17 55666400 splice site probably benign
R1164:Pot1b UTSW 17 55674085 missense probably benign 0.18
R1476:Pot1b UTSW 17 55653451 missense possibly damaging 0.73
R1874:Pot1b UTSW 17 55654805 missense probably benign
R1955:Pot1b UTSW 17 55674067 missense possibly damaging 0.73
R1960:Pot1b UTSW 17 55662531 missense probably damaging 0.99
R1961:Pot1b UTSW 17 55662531 missense probably damaging 0.99
R2109:Pot1b UTSW 17 55653413 missense probably benign 0.00
R2895:Pot1b UTSW 17 55687939 missense probably damaging 0.98
R4681:Pot1b UTSW 17 55654831 missense probably benign 0.28
R4763:Pot1b UTSW 17 55695160 missense possibly damaging 0.94
R4821:Pot1b UTSW 17 55672885 missense possibly damaging 0.73
R5079:Pot1b UTSW 17 55669801 missense probably benign 0.18
R5146:Pot1b UTSW 17 55672865 nonsense probably null
R5176:Pot1b UTSW 17 55699995 missense probably benign 0.05
R5394:Pot1b UTSW 17 55700063 missense probably benign 0.19
R5752:Pot1b UTSW 17 55687834 missense probably damaging 0.99
R6866:Pot1b UTSW 17 55653474 missense possibly damaging 0.83
X0062:Pot1b UTSW 17 55695154 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGACTCTATACTTAAAAGCCCAGC -3'
(R):5'- GGCCACTGACTAGAATGTAGC -3'

Sequencing Primer
(F):5'- AGCCCAGCAATCTTATTTTTGGCTAG -3'
(R):5'- CTGTATTTAGAGGGCTCTGC -3'
Posted On2014-12-29