Incidental Mutation 'R2945:Caprin1'
ID255841
Institutional Source Beutler Lab
Gene Symbol Caprin1
Ensembl Gene ENSMUSG00000027184
Gene Namecell cycle associated protein 1
Synonymscaprin-1, RNG105, MMGPIP137, Gpiap1
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.612) question?
Stock #R2945 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location103762941-103797649 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103772809 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 470 (S470P)
Ref Sequence ENSEMBL: ENSMUSP00000106777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028607] [ENSMUST00000111147] [ENSMUST00000145606]
Predicted Effect probably benign
Transcript: ENSMUST00000028607
AA Change: S470P

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000028607
Gene: ENSMUSG00000027184
AA Change: S470P

DomainStartEndE-ValueType
low complexity region 2 43 N/A INTRINSIC
coiled coil region 52 93 N/A INTRINSIC
low complexity region 176 186 N/A INTRINSIC
low complexity region 271 280 N/A INTRINSIC
low complexity region 309 322 N/A INTRINSIC
low complexity region 326 335 N/A INTRINSIC
Pfam:Caprin-1_C 365 681 1.4e-173 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111147
AA Change: S470P

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000106777
Gene: ENSMUSG00000027184
AA Change: S470P

DomainStartEndE-ValueType
low complexity region 2 43 N/A INTRINSIC
coiled coil region 52 93 N/A INTRINSIC
low complexity region 176 186 N/A INTRINSIC
low complexity region 271 280 N/A INTRINSIC
low complexity region 309 322 N/A INTRINSIC
low complexity region 326 335 N/A INTRINSIC
Pfam:Caprin-1_C 365 680 2.4e-135 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137572
Predicted Effect probably benign
Transcript: ENSMUST00000143188
SMART Domains Protein: ENSMUSP00000114423
Gene: ENSMUSG00000027184

DomainStartEndE-ValueType
low complexity region 84 93 N/A INTRINSIC
low complexity region 122 135 N/A INTRINSIC
low complexity region 139 148 N/A INTRINSIC
Pfam:Caprin-1_C 178 254 4.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143349
SMART Domains Protein: ENSMUSP00000117733
Gene: ENSMUSG00000027184

DomainStartEndE-ValueType
Pfam:Caprin-1_C 1 202 8.2e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145606
SMART Domains Protein: ENSMUSP00000119327
Gene: ENSMUSG00000027184

DomainStartEndE-ValueType
Pfam:Caprin-1_C 1 33 2.9e-11 PFAM
Pfam:Caprin-1_C 32 82 1.4e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149175
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased fetal size, bent posture, cyanosis, respiratory failure, and neonatal lethality with impaired neuronal network development and reduced dendritic localization of sodium potassium ATPase subunit isoform mRNAs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 8 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acd G A 8: 105,700,295 Q132* probably null Het
Bag4 C T 8: 25,771,252 A154T probably benign Het
Dsg3 A G 18: 20,539,935 T888A probably benign Het
Fam111a C A 19: 12,587,866 C326* probably null Het
Nbeal2 A G 9: 110,628,068 V2310A possibly damaging Het
Purg T A 8: 33,386,643 I103N probably damaging Het
Unc5c A T 3: 141,789,974 N461Y probably damaging Het
Utrn T C 10: 12,486,391 T290A possibly damaging Het
Other mutations in Caprin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Caprin1 APN 2 103775456 missense probably benign 0.00
IGL01369:Caprin1 APN 2 103768865 missense probably damaging 0.99
IGL02054:Caprin1 APN 2 103771798 splice site probably null
IGL02260:Caprin1 APN 2 103779369 missense probably damaging 1.00
IGL02526:Caprin1 APN 2 103775603 unclassified probably benign
IGL03405:Caprin1 APN 2 103779505 missense probably damaging 1.00
R0027:Caprin1 UTSW 2 103775580 unclassified probably benign
R0396:Caprin1 UTSW 2 103769569 missense probably damaging 0.99
R0603:Caprin1 UTSW 2 103796801 missense probably benign 0.01
R1406:Caprin1 UTSW 2 103775987 missense probably benign 0.39
R1406:Caprin1 UTSW 2 103775987 missense probably benign 0.39
R1558:Caprin1 UTSW 2 103775987 missense possibly damaging 0.75
R1657:Caprin1 UTSW 2 103769506 missense probably damaging 0.99
R3946:Caprin1 UTSW 2 103796766 missense probably damaging 0.99
R5208:Caprin1 UTSW 2 103769433 critical splice donor site probably null
R6108:Caprin1 UTSW 2 103776017 missense possibly damaging 0.93
R6603:Caprin1 UTSW 2 103775511 missense probably benign 0.01
R7247:Caprin1 UTSW 2 103779474 missense possibly damaging 0.63
R7338:Caprin1 UTSW 2 103779423 missense probably benign 0.01
R7624:Caprin1 UTSW 2 103772677 missense possibly damaging 0.81
R7749:Caprin1 UTSW 2 103771754 missense probably benign 0.03
R7946:Caprin1 UTSW 2 103772748 missense probably damaging 0.99
R8304:Caprin1 UTSW 2 103769517 missense probably damaging 1.00
R8324:Caprin1 UTSW 2 103783181 nonsense probably null
R8547:Caprin1 UTSW 2 103769517 missense probably damaging 1.00
R8549:Caprin1 UTSW 2 103769517 missense probably damaging 1.00
R8782:Caprin1 UTSW 2 103772788 missense probably benign 0.06
R8946:Caprin1 UTSW 2 103778033 missense probably damaging 1.00
Z1177:Caprin1 UTSW 2 103775934 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- CTCCGTTTTGAGATTCATACACAC -3'
(R):5'- AGCCATCTCATGCTACGGAG -3'

Sequencing Primer
(F):5'- CTAGAAAATGCTAAGTGCTCACCG -3'
(R):5'- CCAATGGATCAGATTCAGGTAAGTTC -3'
Posted On2014-12-29