Mutagenetix > Incidental Mutation

Incidental Mutation 'R0319:P3h2'

25585

Institutional Source

Beutler Lab

Gene Symbol

P3h2

Ensembl Gene

ENSMUSG00000038168

Gene Name

prolyl 3-hydroxylase 2

Synonyms

Leprel1

MMRRC Submission

038529-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0319 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25959288-26105784 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 25970931 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 529 (I529F)

Ref Sequence

ENSEMBL: ENSMUSP00000038056 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039990]

AlphaFold

Q8CG71

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039990
AA Change: I529F

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000038056
Gene: ENSMUSG00000038168
AA Change: I529F

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
low complexity region	27	36	N/A	INTRINSIC
Pfam:TPR_2	42	73	2.5e-5	PFAM
low complexity region	81	104	N/A	INTRINSIC
low complexity region	114	123	N/A	INTRINSIC
Pfam:TPR_2	206	237	1.2e-5	PFAM
low complexity region	253	266	N/A	INTRINSIC
internal_repeat_1	304	366	4.75e-7	PROSPERO
P4Hc	457	665	1.45e-51	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160067

Meta Mutation Damage Score

0.0779

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 95.0%
20x: 89.1%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the prolyl 3-hydroxylase subfamily of 2-oxo-glutarate-dependent dioxygenases. These enzymes play a critical role in collagen chain assembly, stability and cross-linking by catalyzing post-translational 3-hydroxylation of proline residues. Mutations in this gene are associated with nonsyndromic severe myopia with cataract and vitreoretinal degeneration, and downregulation of this gene may play a role in breast cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele of exon 2 exhibit embryonic lethality between E8.5 and E12.5 with maternal platelets aggregate around the ectoplacental cone. Exon 3 knockouts are viable but mice exhibit reduced hydroxylation of collagen chains, especially in the sclera, leading to eye tissue dysmorphology and progressive myopia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130023H24Rik	A	C	7: 128,237,190	V77G	probably benign	Het
Abcb1b	A	G	5: 8,827,428	R663G	probably benign	Het
Acly	A	G	11: 100,504,982	V404A	probably damaging	Het
Actg2	T	A	6: 83,520,743	I103F	probably damaging	Het
Anapc5	A	G	5: 122,818,856	V120A	probably damaging	Het
Ankk1	T	G	9: 49,416,071	T603P	probably damaging	Het
Ankmy2	T	C	12: 36,165,899	S33P	possibly damaging	Het
Arhgef19	A	T	4: 141,256,399	T748S	possibly damaging	Het
Atad5	T	A	11: 80,120,790		probably benign	Het
Atxn10	T	C	15: 85,365,282	L105P	probably damaging	Het
Cacna1s	T	C	1: 136,070,717	V161A	probably damaging	Het
Col6a3	T	C	1: 90,807,704	E741G	possibly damaging	Het
Cpne9	G	A	6: 113,294,693	G338E	probably damaging	Het
Cyp3a13	G	A	5: 137,898,862	P397S	probably damaging	Het
Dbn1	C	T	13: 55,474,916	E585K	probably damaging	Het
Dirc2	T	C	16: 35,750,514	D140G	probably benign	Het
Draxin	A	G	4: 148,115,972	L7P	probably benign	Het
Exosc7	T	A	9: 123,130,960		probably benign	Het
Far2	A	G	6: 148,157,470	E218G	probably damaging	Het
Ggps1	A	C	13: 14,053,877	N240K	possibly damaging	Het
Kcnip1	T	C	11: 33,651,529		probably benign	Het
Kcnv2	A	T	19: 27,324,024	Y425F	probably benign	Het
Kdelr2	T	A	5: 143,412,517	F40I	probably damaging	Het
Kdm1b	C	T	13: 47,053,719	P173L	probably benign	Het
Kif20b	G	A	19: 34,947,732		probably benign	Het
Klhl9	A	T	4: 88,720,454	Y517N	possibly damaging	Het
Lgals3bp	A	G	11: 118,393,521	S411P	probably damaging	Het
Lmo3	G	A	6: 138,377,311	T85M	probably damaging	Het
Lvrn	C	A	18: 46,864,753	T256N	probably damaging	Het
Malt1	T	C	18: 65,462,915		probably null	Het
Mgst1	A	G	6: 138,156,157	I157V	possibly damaging	Het
Mob3a	A	T	10: 80,689,985	V164E	possibly damaging	Het
Mprip	T	A	11: 59,697,038		probably benign	Het
Mst1	A	G	9: 108,082,513	N276S	probably benign	Het
Olfr1437	A	T	19: 12,322,316	C170*	probably null	Het
Pikfyve	T	A	1: 65,246,331	S865T	probably benign	Het
Rcbtb2	G	A	14: 73,178,469	R474Q	probably benign	Het
Rpl27	G	A	11: 101,443,495		probably benign	Het
Rtp1	G	A	16: 23,431,460	E192K	probably damaging	Het
Sgk2	T	C	2: 162,995,672		probably benign	Het
Slc17a3	C	T	13: 23,855,858	S293F	probably damaging	Het
Spdl1	T	C	11: 34,823,520	N114S	possibly damaging	Het
Syne2	C	T	12: 76,064,162	R5756W	probably damaging	Het
Tor1aip1	T	C	1: 156,007,181	E307G	probably damaging	Het
Tpd52	T	C	3: 8,953,689	T44A	probably benign	Het
Trim67	A	T	8: 124,823,227	Y532F	probably damaging	Het
Ttll9	C	A	2: 153,000,098		probably null	Het
Ush2a	T	C	1: 188,948,374		probably benign	Het
Vcam1	T	C	3: 116,116,060	I539M	probably benign	Het
Vmn1r19	T	A	6: 57,404,615	M51K	possibly damaging	Het
Vmn2r61	T	A	7: 42,300,517	M787K	probably damaging	Het
Xdh	T	A	17: 73,906,101		probably benign	Het
Zfp109	A	T	7: 24,234,470	V8E	probably damaging	Het
Zfp595	G	A	13: 67,316,513	A562V	possibly damaging	Het
Zfp759	A	G	13: 67,140,292	T636A	probably benign	Het

Other mutations in P3h2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00825:P3h2	APN	16	25992798	missense	probably damaging	1.00
IGL01012:P3h2	APN	16	25987248	missense	probably damaging	0.98
IGL02393:P3h2	APN	16	25992825	missense	probably damaging	1.00
IGL02436:P3h2	APN	16	25997200	missense	probably benign	0.01
PIT4445001:P3h2	UTSW	16	25984999	missense	probably benign	0.01
R0403:P3h2	UTSW	16	25969950	missense	possibly damaging	0.63
R0962:P3h2	UTSW	16	25997248	missense	probably benign
R1290:P3h2	UTSW	16	25987203	missense	probably damaging	0.99
R1300:P3h2	UTSW	16	25997236	nonsense	probably null
R1467:P3h2	UTSW	16	25965868	splice site	probably benign
R1643:P3h2	UTSW	16	25972291	missense	probably benign	0.00
R1645:P3h2	UTSW	16	25997232	missense	probably damaging	1.00
R1761:P3h2	UTSW	16	25985050	missense	probably damaging	0.96
R4227:P3h2	UTSW	16	26105453	missense	probably benign
R4273:P3h2	UTSW	16	26105221	missense	probably benign	0.00
R4409:P3h2	UTSW	16	26105290	missense	possibly damaging	0.88
R4410:P3h2	UTSW	16	26105290	missense	possibly damaging	0.88
R4653:P3h2	UTSW	16	26105277	missense	probably damaging	0.98
R4968:P3h2	UTSW	16	25992662	critical splice donor site	probably null
R5190:P3h2	UTSW	16	25984949	missense	possibly damaging	0.86
R6113:P3h2	UTSW	16	25981153	missense	probably benign	0.01
R6225:P3h2	UTSW	16	25965743	missense	probably damaging	0.97
R6838:P3h2	UTSW	16	26105284	missense	possibly damaging	0.73
R6881:P3h2	UTSW	16	25992745	missense	probably damaging	1.00
R7089:P3h2	UTSW	16	25965809	missense	probably damaging	1.00
R7445:P3h2	UTSW	16	25985065	missense	probably damaging	0.96
R7753:P3h2	UTSW	16	25970937	missense	probably damaging	1.00
R8166:P3h2	UTSW	16	25992822	missense	possibly damaging	0.89
R8363:P3h2	UTSW	16	25992718	missense	probably damaging	0.98
R8442:P3h2	UTSW	16	25987205	missense	probably benign	0.05
R8812:P3h2	UTSW	16	25982717	missense	possibly damaging	0.67
R8965:P3h2	UTSW	16	25972384	missense	probably benign	0.41
R9187:P3h2	UTSW	16	26105436	missense	probably benign	0.27
R9193:P3h2	UTSW	16	26105241	missense	probably benign	0.07
R9533:P3h2	UTSW	16	25970975	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCCTGAGTCCCTGAAGCCCAAAG -3'
(R):5'- TTCACTGATGCGGAGATGGCAGTC -3'

Sequencing Primer
(F):5'- AGCCATTATGAGAAATGGGTTTG -3'
(R):5'- GCAGTCTGTATTCTCTTAATGAAACC -3'

Posted On

2013-04-16