Mutagenetix > Incidental Mutation

Incidental Mutation 'R2959:Dnajc16'

255855

Institutional Source

Beutler Lab

Gene Symbol

Dnajc16

Ensembl Gene

ENSMUSG00000040697

Gene Name

DnaJ heat shock protein family (Hsp40) member C16

Synonyms

4732437J24Rik, 2900037O03Rik

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.736) question?

Stock #

R2959 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

141760189-141790931 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 141766545 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 571 (K571*)

Ref Sequence

ENSEMBL: ENSMUSP00000048714 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038014]

AlphaFold

Q80TN4

PDB Structure

Solution structure of the J domain of the pseudo DnaJ protein, mouse hypothetical mKIAA0962 [SOLUTION NMR]

Predicted Effect

probably null
Transcript: ENSMUST00000038014
AA Change: K571*

SMART Domains

Protein: ENSMUSP00000048714
Gene: ENSMUSG00000040697
AA Change: K571*

Domain	Start	End	E-Value	Type
DnaJ	28	85	4.5e-30	SMART
Pfam:Thioredoxin	142	243	4.4e-8	PFAM
low complexity region	537	549	N/A	INTRINSIC
low complexity region	730	750	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138654

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 12 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Angptl4	G	A	17: 33,777,034	P323S	possibly damaging	Het
Cdk5rap2	ATGTG	ATG	4: 70,289,977		probably null	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably null	Het
Gm5407	A	T	16: 49,296,963		noncoding transcript	Het
Gpd2	C	T	2: 57,338,975	R264*	probably null	Het
H2-M2	T	C	17: 37,483,454	T26A	probably benign	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Prpf39	T	C	12: 65,042,523	S12P	probably damaging	Het
Prss1	G	T	6: 41,463,238	D170Y	probably damaging	Het
Satb1	T	C	17: 51,775,303	D441G	possibly damaging	Het
Tas2r106	A	T	6: 131,678,105	L261*	probably null	Het
Zfp719	T	A	7: 43,590,427	S480T	possibly damaging	Het

Other mutations in Dnajc16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00495:Dnajc16	APN	4	141763563	splice site	probably null
IGL00840:Dnajc16	APN	4	141768003	missense	probably damaging	1.00
IGL01503:Dnajc16	APN	4	141763697	missense	possibly damaging	0.65
IGL01919:Dnajc16	APN	4	141774629	missense	probably benign	0.06
IGL02065:Dnajc16	APN	4	141776933	missense	probably damaging	1.00
IGL02544:Dnajc16	APN	4	141764647	missense	probably damaging	1.00
IGL03028:Dnajc16	APN	4	141767732	nonsense	probably null
PIT4418001:Dnajc16	UTSW	4	141770949	missense	probably damaging	0.99
PIT4585001:Dnajc16	UTSW	4	141764685	missense	probably damaging	1.00
R0071:Dnajc16	UTSW	4	141768007	missense	probably benign
R0415:Dnajc16	UTSW	4	141789048	nonsense	probably null
R0532:Dnajc16	UTSW	4	141789009	missense	probably damaging	1.00
R1418:Dnajc16	UTSW	4	141767741	nonsense	probably null
R3025:Dnajc16	UTSW	4	141774611	missense	probably benign
R3796:Dnajc16	UTSW	4	141767737	missense	probably benign
R3854:Dnajc16	UTSW	4	141763653	nonsense	probably null
R3856:Dnajc16	UTSW	4	141763653	nonsense	probably null
R4661:Dnajc16	UTSW	4	141763548	missense	probably damaging	1.00
R4841:Dnajc16	UTSW	4	141774625	missense	probably damaging	1.00
R4842:Dnajc16	UTSW	4	141774625	missense	probably damaging	1.00
R5116:Dnajc16	UTSW	4	141767969	nonsense	probably null
R5126:Dnajc16	UTSW	4	141774509	missense	probably benign	0.01
R5140:Dnajc16	UTSW	4	141764683	missense	possibly damaging	0.85
R5275:Dnajc16	UTSW	4	141767928	missense	possibly damaging	0.82
R5295:Dnajc16	UTSW	4	141767928	missense	possibly damaging	0.82
R5891:Dnajc16	UTSW	4	141775392	missense	probably benign
R6888:Dnajc16	UTSW	4	141776992	missense	probably benign	0.24
R7062:Dnajc16	UTSW	4	141766690	missense	probably damaging	1.00
R7441:Dnajc16	UTSW	4	141763813	missense	probably damaging	1.00
R7684:Dnajc16	UTSW	4	141774568	missense	probably benign	0.02
R8843:Dnajc16	UTSW	4	141764691	missense	possibly damaging	0.87
R8924:Dnajc16	UTSW	4	141766707	nonsense	probably null
R9005:Dnajc16	UTSW	4	141764634	missense	possibly damaging	0.95
R9053:Dnajc16	UTSW	4	141783060	missense	probably benign	0.28
R9550:Dnajc16	UTSW	4	141767747	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- TGAGTAGCACATGTGAGGC -3'
(R):5'- AAAGCCAGATCCCGAGGTTG -3'

Sequencing Primer
(F):5'- TGAGGCCCTGGGTTCCATAC -3'
(R):5'- AGATGATGCCCCTGCTGTC -3'

Posted On

2014-12-29