Incidental Mutation 'R2959:Dnajc16'
ID255855
Institutional Source Beutler Lab
Gene Symbol Dnajc16
Ensembl Gene ENSMUSG00000040697
Gene NameDnaJ heat shock protein family (Hsp40) member C16
Synonyms4732437J24Rik, 2900037O03Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.685) question?
Stock #R2959 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location141760189-141790931 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 141766545 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 571 (K571*)
Ref Sequence ENSEMBL: ENSMUSP00000048714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038014]
PDB Structure Solution structure of the J domain of the pseudo DnaJ protein, mouse hypothetical mKIAA0962 [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000038014
AA Change: K571*
SMART Domains Protein: ENSMUSP00000048714
Gene: ENSMUSG00000040697
AA Change: K571*

DomainStartEndE-ValueType
DnaJ 28 85 4.5e-30 SMART
Pfam:Thioredoxin 142 243 4.4e-8 PFAM
low complexity region 537 549 N/A INTRINSIC
low complexity region 730 750 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138654
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 12 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl4 G A 17: 33,777,034 P323S possibly damaging Het
Cdk5rap2 ATGTG ATG 4: 70,289,977 probably null Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm5407 A T 16: 49,296,963 noncoding transcript Het
Gpd2 C T 2: 57,338,975 R264* probably null Het
H2-M2 T C 17: 37,483,454 T26A probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Prpf39 T C 12: 65,042,523 S12P probably damaging Het
Prss1 G T 6: 41,463,238 D170Y probably damaging Het
Satb1 T C 17: 51,775,303 D441G possibly damaging Het
Tas2r106 A T 6: 131,678,105 L261* probably null Het
Zfp719 T A 7: 43,590,427 S480T possibly damaging Het
Other mutations in Dnajc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Dnajc16 APN 4 141763563 splice site probably null
IGL00840:Dnajc16 APN 4 141768003 missense probably damaging 1.00
IGL01503:Dnajc16 APN 4 141763697 missense possibly damaging 0.65
IGL01919:Dnajc16 APN 4 141774629 missense probably benign 0.06
IGL02065:Dnajc16 APN 4 141776933 missense probably damaging 1.00
IGL02544:Dnajc16 APN 4 141764647 missense probably damaging 1.00
IGL03028:Dnajc16 APN 4 141767732 nonsense probably null
PIT4418001:Dnajc16 UTSW 4 141770949 missense probably damaging 0.99
PIT4585001:Dnajc16 UTSW 4 141764685 missense probably damaging 1.00
R0071:Dnajc16 UTSW 4 141768007 missense probably benign
R0415:Dnajc16 UTSW 4 141789048 nonsense probably null
R0532:Dnajc16 UTSW 4 141789009 missense probably damaging 1.00
R1418:Dnajc16 UTSW 4 141767741 nonsense probably null
R3025:Dnajc16 UTSW 4 141774611 missense probably benign
R3796:Dnajc16 UTSW 4 141767737 missense probably benign
R3854:Dnajc16 UTSW 4 141763653 nonsense probably null
R3856:Dnajc16 UTSW 4 141763653 nonsense probably null
R4661:Dnajc16 UTSW 4 141763548 missense probably damaging 1.00
R4841:Dnajc16 UTSW 4 141774625 missense probably damaging 1.00
R4842:Dnajc16 UTSW 4 141774625 missense probably damaging 1.00
R5116:Dnajc16 UTSW 4 141767969 nonsense probably null
R5126:Dnajc16 UTSW 4 141774509 missense probably benign 0.01
R5140:Dnajc16 UTSW 4 141764683 missense possibly damaging 0.85
R5275:Dnajc16 UTSW 4 141767928 missense possibly damaging 0.82
R5295:Dnajc16 UTSW 4 141767928 missense possibly damaging 0.82
R5891:Dnajc16 UTSW 4 141775392 missense probably benign
R6888:Dnajc16 UTSW 4 141776992 missense probably benign 0.24
R7062:Dnajc16 UTSW 4 141766690 missense probably damaging 1.00
R7441:Dnajc16 UTSW 4 141763813 missense probably damaging 1.00
R7684:Dnajc16 UTSW 4 141774568 missense probably benign 0.02
R8843:Dnajc16 UTSW 4 141764691 missense possibly damaging 0.87
R8924:Dnajc16 UTSW 4 141766707 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAGTAGCACATGTGAGGC -3'
(R):5'- AAAGCCAGATCCCGAGGTTG -3'

Sequencing Primer
(F):5'- TGAGGCCCTGGGTTCCATAC -3'
(R):5'- AGATGATGCCCCTGCTGTC -3'
Posted On2014-12-29