Incidental Mutation 'R2959:Angptl4'
ID255863
Institutional Source Beutler Lab
Gene Symbol Angptl4
Ensembl Gene ENSMUSG00000002289
Gene Nameangiopoietin-like 4
SynonymsFIAF, BK89, NG27, HFARP
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2959 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location33773750-33781575 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 33777034 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 323 (P323S)
Ref Sequence ENSEMBL: ENSMUSP00000002360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002360] [ENSMUST00000173869]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002360
AA Change: P323S

PolyPhen 2 Score 0.541 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000002360
Gene: ENSMUSG00000002289
AA Change: P323S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
coiled coil region 104 151 N/A INTRINSIC
FBG 187 404 6.6e-69 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173869
SMART Domains Protein: ENSMUSP00000133417
Gene: ENSMUSG00000002289

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
coiled coil region 104 147 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174858
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174872
Meta Mutation Damage Score 0.036 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosylated, secreted protein containing a C-terminal fibrinogen domain. The encoded protein is induced by peroxisome proliferation activators and functions as a serum hormone that regulates glucose homeostasis, lipid metabolism, and insulin sensitivity. This protein can also act as an apoptosis survival factor for vascular endothelial cells and can prevent metastasis by inhibiting vascular growth and tumor cell invasion. The C-terminal domain may be proteolytically-cleaved from the full-length secreted protein. Decreased expression of this gene has been associated with type 2 diabetes. Alternative splicing results in multiple transcript variants. This gene was previously referred to as ANGPTL2 but has been renamed ANGPTL4. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display decreased levels of triglycerides and cholesterol and a lower increase in body fat after exposure to gut microbiota. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 12 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cdk5rap2 ATGTG ATG 4: 70,289,977 probably null Het
Dnajc16 T A 4: 141,766,545 K571* probably null Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm5407 A T 16: 49,296,963 noncoding transcript Het
Gpd2 C T 2: 57,338,975 R264* probably null Het
H2-M2 T C 17: 37,483,454 T26A probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Prpf39 T C 12: 65,042,523 S12P probably damaging Het
Prss1 G T 6: 41,463,238 D170Y probably damaging Het
Satb1 T C 17: 51,775,303 D441G possibly damaging Het
Tas2r106 A T 6: 131,678,105 L261* probably null Het
Zfp719 T A 7: 43,590,427 S480T possibly damaging Het
Other mutations in Angptl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Angptl4 APN 17 33781268 missense probably damaging 1.00
R0117:Angptl4 UTSW 17 33780802 missense probably damaging 1.00
R1225:Angptl4 UTSW 17 33781191 missense possibly damaging 0.73
R1491:Angptl4 UTSW 17 33781191 missense possibly damaging 0.73
R1932:Angptl4 UTSW 17 33781275 nonsense probably null
R2055:Angptl4 UTSW 17 33780524 splice site probably null
R2212:Angptl4 UTSW 17 33775418 missense probably damaging 0.99
R2963:Angptl4 UTSW 17 33777034 missense possibly damaging 0.54
R3877:Angptl4 UTSW 17 33777034 missense possibly damaging 0.54
R3881:Angptl4 UTSW 17 33777034 missense possibly damaging 0.54
R3882:Angptl4 UTSW 17 33777034 missense possibly damaging 0.54
R4646:Angptl4 UTSW 17 33781299 missense probably benign 0.00
R4660:Angptl4 UTSW 17 33777275 intron probably benign
R6192:Angptl4 UTSW 17 33777041 missense probably benign 0.09
R6591:Angptl4 UTSW 17 33780781 critical splice donor site probably null
R6691:Angptl4 UTSW 17 33780781 critical splice donor site probably null
R7350:Angptl4 UTSW 17 33777110 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGTAGCTCTGTGCCAGAATG -3'
(R):5'- TGCACAGCATCACAGGGAAC -3'

Sequencing Primer
(F):5'- TTCAATGACTGGCCCATAGG -3'
(R):5'- ACCGAGGAAGCCAATTGG -3'
Posted On2014-12-29