Incidental Mutation 'R2959:H2-M2'
ID 255864
Institutional Source Beutler Lab
Gene Symbol H2-M2
Ensembl Gene ENSMUSG00000016283
Gene Name histocompatibility 2, M region locus 2
Synonyms Thy19.4, H-2M2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock # R2959 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 37480851-37483552 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 37483454 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 26 (T26A)
Ref Sequence ENSEMBL: ENSMUSP00000131297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016427] [ENSMUST00000171139]
AlphaFold Q6W9L1
Predicted Effect probably benign
Transcript: ENSMUST00000016427
AA Change: T26A

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000016427
Gene: ENSMUSG00000016283
AA Change: T26A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:MHC_I 29 207 1.6e-77 PFAM
IGc1 226 297 2.11e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171139
AA Change: T26A

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000131297
Gene: ENSMUSG00000016283
AA Change: T26A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:MHC_I 29 207 7.1e-76 PFAM
IGc1 226 297 2.11e-20 SMART
transmembrane domain 308 330 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 12 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Angptl4 G A 17: 33,777,034 P323S possibly damaging Het
Cdk5rap2 ATGTG ATG 4: 70,289,977 probably null Het
Dnajc16 T A 4: 141,766,545 K571* probably null Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm5407 A T 16: 49,296,963 noncoding transcript Het
Gpd2 C T 2: 57,338,975 R264* probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Prpf39 T C 12: 65,042,523 S12P probably damaging Het
Prss1 G T 6: 41,463,238 D170Y probably damaging Het
Satb1 T C 17: 51,775,303 D441G possibly damaging Het
Tas2r106 A T 6: 131,678,105 L261* probably null Het
Zfp719 T A 7: 43,590,427 S480T possibly damaging Het
Other mutations in H2-M2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01683:H2-M2 APN 17 37481515 missense possibly damaging 0.95
Lock UTSW 17 37481508 missense probably damaging 1.00
Nokia UTSW 17 37481306 missense possibly damaging 0.59
R0799:H2-M2 UTSW 17 37482749 missense probably damaging 1.00
R0981:H2-M2 UTSW 17 37482630 missense probably benign 0.02
R1925:H2-M2 UTSW 17 37482500 missense probably damaging 0.98
R3968:H2-M2 UTSW 17 37481306 missense possibly damaging 0.59
R4063:H2-M2 UTSW 17 37481508 missense probably damaging 1.00
R4735:H2-M2 UTSW 17 37483244 missense possibly damaging 0.91
R5806:H2-M2 UTSW 17 37481726 missense probably damaging 1.00
R6410:H2-M2 UTSW 17 37483213 missense probably damaging 1.00
R7432:H2-M2 UTSW 17 37481470 critical splice donor site probably null
R7456:H2-M2 UTSW 17 37481661 missense possibly damaging 0.60
R7535:H2-M2 UTSW 17 37482637 missense probably benign 0.07
R7680:H2-M2 UTSW 17 37483025 missense possibly damaging 0.56
R8112:H2-M2 UTSW 17 37483492 missense unknown
R8910:H2-M2 UTSW 17 37481522 missense probably damaging 1.00
R9034:H2-M2 UTSW 17 37481285 missense probably benign 0.05
R9193:H2-M2 UTSW 17 37482537 missense probably benign 0.00
R9420:H2-M2 UTSW 17 37481324 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AAGGCTGATGTTTGGCTTGAAC -3'
(R):5'- CATGGACACTGATGACTATGCTC -3'

Sequencing Primer
(F):5'- GATGTTTGGCTTGAACCTTCTTC -3'
(R):5'- GGACACTGATGACTATGCTCCAATTC -3'
Posted On 2014-12-29