Incidental Mutation 'R2960:Rfx8'
ID255867
Institutional Source Beutler Lab
Gene Symbol Rfx8
Ensembl Gene ENSMUSG00000057173
Gene Nameregulatory factor X 8
Synonyms4933400N17Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2960 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location39665301-39720997 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39682952 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 291 (V291A)
Ref Sequence ENSEMBL: ENSMUSP00000121212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000151913]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126760
Predicted Effect probably damaging
Transcript: ENSMUST00000151913
AA Change: V291A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000121212
Gene: ENSMUSG00000057173
AA Change: V291A

DomainStartEndE-ValueType
Pfam:RFX_DNA_binding 17 94 6.5e-31 PFAM
Blast:DEXDc 301 358 4e-8 BLAST
low complexity region 445 467 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl5c A G 11: 97,995,076 L33P probably damaging Het
Auh A T 13: 52,839,574 I268N probably damaging Het
Defa25 A T 8: 21,085,257 H84L probably benign Het
E130309D02Rik A T 5: 143,308,021 F234I probably benign Het
Endou T C 15: 97,713,806 Y317C probably damaging Het
Fmn2 C T 1: 174,609,819 L1119F probably damaging Het
Glyat T A 19: 12,639,850 L22H probably damaging Het
Gpd2 C T 2: 57,338,975 R264* probably null Het
Grb7 C T 11: 98,452,261 T268I probably damaging Het
Itfg2 G A 6: 128,413,552 A190V probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lexm A G 4: 106,613,418 S186P probably damaging Het
Mdga2 G T 12: 66,629,978 Y513* probably null Het
Med8 A G 4: 118,414,747 T222A probably damaging Het
Nup43 T C 10: 7,670,949 V111A probably benign Het
Olfr1410 A G 1: 92,608,328 I164V probably benign Het
Rfx3 G A 19: 27,900,811 Q29* probably null Het
Scnn1a A G 6: 125,322,293 Y112C probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tmx3 T C 18: 90,532,992 V252A probably damaging Het
Vmn1r216 A G 13: 23,099,933 D262G probably benign Het
Vmn1r9 A G 6: 57,071,672 D244G possibly damaging Het
Xkr6 T A 14: 63,607,137 M203K possibly damaging Het
Zfr G A 15: 12,162,233 R823H probably benign Het
Other mutations in Rfx8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Rfx8 APN 1 39682950 nonsense probably null
IGL01659:Rfx8 APN 1 39670573 missense probably damaging 1.00
IGL02239:Rfx8 APN 1 39680886 missense probably benign 0.00
IGL02302:Rfx8 APN 1 39665522 missense possibly damaging 0.50
IGL02332:Rfx8 APN 1 39718480 missense possibly damaging 0.89
IGL02598:Rfx8 APN 1 39695968 splice site probably benign
IGL02870:Rfx8 APN 1 39683711 missense possibly damaging 0.94
IGL03403:Rfx8 APN 1 39690173 missense possibly damaging 0.94
PIT4515001:Rfx8 UTSW 1 39690105 missense probably benign 0.04
R0060:Rfx8 UTSW 1 39718405 splice site probably benign
R0095:Rfx8 UTSW 1 39685536 missense possibly damaging 0.58
R0265:Rfx8 UTSW 1 39688577 missense possibly damaging 0.67
R1892:Rfx8 UTSW 1 39670586 splice site probably null
R2054:Rfx8 UTSW 1 39685559 missense possibly damaging 0.92
R4554:Rfx8 UTSW 1 39680940 missense probably benign 0.00
R5410:Rfx8 UTSW 1 39710156 critical splice donor site probably null
R5496:Rfx8 UTSW 1 39670347 missense probably benign 0.01
R5502:Rfx8 UTSW 1 39682953 missense probably damaging 1.00
R5916:Rfx8 UTSW 1 39688619 missense probably benign 0.20
R6238:Rfx8 UTSW 1 39670394 missense probably damaging 0.96
R6360:Rfx8 UTSW 1 39680965 missense probably benign
R7593:Rfx8 UTSW 1 39683678 missense probably damaging 1.00
R7738:Rfx8 UTSW 1 39682931 missense probably damaging 1.00
T0722:Rfx8 UTSW 1 39683612 missense probably damaging 1.00
Z1088:Rfx8 UTSW 1 39682966 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TTGCACCATGGGTTCTCCTG -3'
(R):5'- TAGGATTCTACAAGTCTCTGCCAC -3'

Sequencing Primer
(F):5'- ACCATGGGTTCTCCTGTCTGC -3'
(R):5'- CACAGGCTTAGATTGGGCATGC -3'
Posted On2014-12-29