Incidental Mutation 'R0319:Xdh'
ID25587
Institutional Source Beutler Lab
Gene Symbol Xdh
Ensembl Gene ENSMUSG00000024066
Gene Namexanthine dehydrogenase
Synonymsxanthine oxidase, XO, Xor, Xox1, Xox-1
MMRRC Submission 038529-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.481) question?
Stock #R0319 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location73883908-73950182 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 73906101 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000024866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024866]
Predicted Effect probably benign
Transcript: ENSMUST00000024866
SMART Domains Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066

DomainStartEndE-ValueType
Pfam:Fer2 11 81 5e-12 PFAM
Pfam:Fer2_2 90 163 4.1e-31 PFAM
low complexity region 169 182 N/A INTRINSIC
Pfam:FAD_binding_5 234 414 4.9e-47 PFAM
CO_deh_flav_C 421 525 1.16e-24 SMART
Ald_Xan_dh_C 590 696 1.23e-46 SMART
Pfam:Ald_Xan_dh_C2 704 1239 1e-200 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 95.0%
  • 20x: 89.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A C 7: 128,237,190 V77G probably benign Het
Abcb1b A G 5: 8,827,428 R663G probably benign Het
Acly A G 11: 100,504,982 V404A probably damaging Het
Actg2 T A 6: 83,520,743 I103F probably damaging Het
Anapc5 A G 5: 122,818,856 V120A probably damaging Het
Ankk1 T G 9: 49,416,071 T603P probably damaging Het
Ankmy2 T C 12: 36,165,899 S33P possibly damaging Het
Arhgef19 A T 4: 141,256,399 T748S possibly damaging Het
Atad5 T A 11: 80,120,790 probably benign Het
Atxn10 T C 15: 85,365,282 L105P probably damaging Het
Cacna1s T C 1: 136,070,717 V161A probably damaging Het
Col6a3 T C 1: 90,807,704 E741G possibly damaging Het
Cpne9 G A 6: 113,294,693 G338E probably damaging Het
Cyp3a13 G A 5: 137,898,862 P397S probably damaging Het
Dbn1 C T 13: 55,474,916 E585K probably damaging Het
Dirc2 T C 16: 35,750,514 D140G probably benign Het
Draxin A G 4: 148,115,972 L7P probably benign Het
Exosc7 T A 9: 123,130,960 probably benign Het
Far2 A G 6: 148,157,470 E218G probably damaging Het
Ggps1 A C 13: 14,053,877 N240K possibly damaging Het
Kcnip1 T C 11: 33,651,529 probably benign Het
Kcnv2 A T 19: 27,324,024 Y425F probably benign Het
Kdelr2 T A 5: 143,412,517 F40I probably damaging Het
Kdm1b C T 13: 47,053,719 P173L probably benign Het
Kif20b G A 19: 34,947,732 probably benign Het
Klhl9 A T 4: 88,720,454 Y517N possibly damaging Het
Lgals3bp A G 11: 118,393,521 S411P probably damaging Het
Lmo3 G A 6: 138,377,311 T85M probably damaging Het
Lvrn C A 18: 46,864,753 T256N probably damaging Het
Malt1 T C 18: 65,462,915 probably null Het
Mgst1 A G 6: 138,156,157 I157V possibly damaging Het
Mob3a A T 10: 80,689,985 V164E possibly damaging Het
Mprip T A 11: 59,697,038 probably benign Het
Mst1 A G 9: 108,082,513 N276S probably benign Het
Olfr1437 A T 19: 12,322,316 C170* probably null Het
P3h2 T A 16: 25,970,931 I529F possibly damaging Het
Pikfyve T A 1: 65,246,331 S865T probably benign Het
Rcbtb2 G A 14: 73,178,469 R474Q probably benign Het
Rpl27 G A 11: 101,443,495 probably benign Het
Rtp1 G A 16: 23,431,460 E192K probably damaging Het
Sgk2 T C 2: 162,995,672 probably benign Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Spdl1 T C 11: 34,823,520 N114S possibly damaging Het
Syne2 C T 12: 76,064,162 R5756W probably damaging Het
Tor1aip1 T C 1: 156,007,181 E307G probably damaging Het
Tpd52 T C 3: 8,953,689 T44A probably benign Het
Trim67 A T 8: 124,823,227 Y532F probably damaging Het
Ttll9 C A 2: 153,000,098 probably null Het
Ush2a T C 1: 188,948,374 probably benign Het
Vcam1 T C 3: 116,116,060 I539M probably benign Het
Vmn1r19 T A 6: 57,404,615 M51K possibly damaging Het
Vmn2r61 T A 7: 42,300,517 M787K probably damaging Het
Zfp109 A T 7: 24,234,470 V8E probably damaging Het
Zfp595 G A 13: 67,316,513 A562V possibly damaging Het
Zfp759 A G 13: 67,140,292 T636A probably benign Het
Other mutations in Xdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Xdh APN 17 73923106 missense possibly damaging 0.58
IGL00556:Xdh APN 17 73884435 makesense probably null
IGL01524:Xdh APN 17 73923137 critical splice acceptor site probably null
IGL01604:Xdh APN 17 73909337 missense probably benign 0.02
IGL01625:Xdh APN 17 73916786 critical splice donor site probably null
IGL01778:Xdh APN 17 73900280 missense probably benign 0.00
IGL01804:Xdh APN 17 73892759 missense probably damaging 1.00
IGL01825:Xdh APN 17 73891245 missense probably damaging 1.00
IGL01929:Xdh APN 17 73934855 missense probably damaging 1.00
IGL02068:Xdh APN 17 73913950 missense probably damaging 1.00
IGL02079:Xdh APN 17 73891277 missense probably damaging 1.00
IGL02210:Xdh APN 17 73943895 missense probably benign 0.00
IGL02261:Xdh APN 17 73913965 missense possibly damaging 0.81
IGL02365:Xdh APN 17 73943890 missense probably benign 0.14
IGL02424:Xdh APN 17 73926570 missense probably benign 0.00
IGL02491:Xdh APN 17 73886464 missense probably damaging 0.99
IGL02525:Xdh APN 17 73924995 missense possibly damaging 0.91
IGL02578:Xdh APN 17 73906246 missense probably damaging 1.00
IGL02793:Xdh APN 17 73900581 missense probably damaging 1.00
IGL02939:Xdh APN 17 73943845 critical splice donor site probably null
IGL03327:Xdh APN 17 73916792 missense probably benign
IGL03345:Xdh APN 17 73906032 missense probably damaging 0.98
IGL03353:Xdh APN 17 73895786 missense possibly damaging 0.65
R0018:Xdh UTSW 17 73925025 missense probably benign 0.00
R0018:Xdh UTSW 17 73925025 missense probably benign 0.00
R0033:Xdh UTSW 17 73907632 missense probably benign 0.06
R0079:Xdh UTSW 17 73891218 missense probably damaging 1.00
R0086:Xdh UTSW 17 73884438 missense probably benign
R0336:Xdh UTSW 17 73922463 missense possibly damaging 0.91
R0389:Xdh UTSW 17 73898362 missense probably damaging 1.00
R0684:Xdh UTSW 17 73943891 missense probably damaging 0.97
R0930:Xdh UTSW 17 73923082 missense probably benign 0.00
R1073:Xdh UTSW 17 73939836 missense probably benign
R1114:Xdh UTSW 17 73941149 splice site probably benign
R1201:Xdh UTSW 17 73918418 missense probably benign 0.05
R1230:Xdh UTSW 17 73891256 missense probably damaging 1.00
R1351:Xdh UTSW 17 73923078 missense probably benign 0.02
R1470:Xdh UTSW 17 73891112 missense probably damaging 1.00
R1470:Xdh UTSW 17 73891112 missense probably damaging 1.00
R1485:Xdh UTSW 17 73914019 nonsense probably null
R1548:Xdh UTSW 17 73913901 missense probably damaging 0.98
R1637:Xdh UTSW 17 73900578 missense probably benign
R1641:Xdh UTSW 17 73926552 missense probably benign
R1758:Xdh UTSW 17 73910209 missense probably damaging 1.00
R1951:Xdh UTSW 17 73907658 missense probably damaging 1.00
R1969:Xdh UTSW 17 73892751 missense possibly damaging 0.55
R2024:Xdh UTSW 17 73921305 missense possibly damaging 0.92
R2080:Xdh UTSW 17 73909325 missense probably damaging 1.00
R2157:Xdh UTSW 17 73922537 missense probably damaging 1.00
R2300:Xdh UTSW 17 73891265 missense probably damaging 1.00
R3783:Xdh UTSW 17 73893595 splice site probably benign
R3796:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3797:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3798:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3799:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3819:Xdh UTSW 17 73906725 missense probably benign 0.35
R4085:Xdh UTSW 17 73916879 missense probably benign 0.35
R4240:Xdh UTSW 17 73895795 missense possibly damaging 0.72
R4356:Xdh UTSW 17 73915690 missense probably benign 0.01
R4522:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4523:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4524:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4600:Xdh UTSW 17 73910200 missense probably benign 0.19
R4617:Xdh UTSW 17 73918394 missense probably damaging 0.99
R4756:Xdh UTSW 17 73886386 missense probably benign 0.24
R4761:Xdh UTSW 17 73910267 missense possibly damaging 0.91
R4815:Xdh UTSW 17 73906215 missense probably damaging 1.00
R4850:Xdh UTSW 17 73898335 missense probably damaging 1.00
R4896:Xdh UTSW 17 73910243 missense probably damaging 0.96
R4897:Xdh UTSW 17 73900708 missense probably benign
R4923:Xdh UTSW 17 73924936 missense possibly damaging 0.72
R4977:Xdh UTSW 17 73898970 missense probably benign 0.05
R5030:Xdh UTSW 17 73891293 missense probably damaging 1.00
R5185:Xdh UTSW 17 73925011 missense probably damaging 1.00
R5347:Xdh UTSW 17 73925032 missense probably benign
R5556:Xdh UTSW 17 73897764 missense probably benign 0.21
R5566:Xdh UTSW 17 73893622 missense probably damaging 1.00
R5568:Xdh UTSW 17 73943885 missense possibly damaging 0.90
R5635:Xdh UTSW 17 73913875 missense possibly damaging 0.92
R5662:Xdh UTSW 17 73941115 missense probably damaging 0.99
R5955:Xdh UTSW 17 73898320 missense probably damaging 1.00
R6058:Xdh UTSW 17 73906269 missense probably damaging 1.00
R6061:Xdh UTSW 17 73921347 missense probably damaging 1.00
R6412:Xdh UTSW 17 73935907 missense probably benign 0.09
R6526:Xdh UTSW 17 73900551 missense probably damaging 0.97
R6558:Xdh UTSW 17 73893713 missense possibly damaging 0.95
R6843:Xdh UTSW 17 73923130 missense probably damaging 1.00
R6932:Xdh UTSW 17 73922562 missense probably damaging 0.99
R7028:Xdh UTSW 17 73943873 missense probably damaging 0.99
R7418:Xdh UTSW 17 73913965 missense possibly damaging 0.81
R7503:Xdh UTSW 17 73926210 missense probably damaging 1.00
R7653:Xdh UTSW 17 73897045 missense probably benign 0.10
R7763:Xdh UTSW 17 73934834 missense possibly damaging 0.69
R7768:Xdh UTSW 17 73939836 missense probably benign
R7904:Xdh UTSW 17 73922472 missense probably benign 0.09
R8010:Xdh UTSW 17 73909317 nonsense probably null
R8067:Xdh UTSW 17 73900657 missense probably benign 0.01
R8238:Xdh UTSW 17 73886417 missense probably benign
R8253:Xdh UTSW 17 73918382 missense possibly damaging 0.94
R8346:Xdh UTSW 17 73913943 missense probably damaging 1.00
R8381:Xdh UTSW 17 73912461 missense probably benign
R8427:Xdh UTSW 17 73935931 missense probably damaging 1.00
X0019:Xdh UTSW 17 73918454 missense probably damaging 1.00
Z1088:Xdh UTSW 17 73886428 missense probably benign
Z1176:Xdh UTSW 17 73923042 critical splice donor site probably null
Z1177:Xdh UTSW 17 73897695 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTAGAGATTGTCCAAGGACGGG -3'
(R):5'- TGTTCTTCAGCACAGCACCACC -3'

Sequencing Primer
(F):5'- CGTGGCTATACAGAAATAATTGGCAG -3'
(R):5'- CAGGAGGCTTACAGGTTTCTAAC -3'
Posted On2013-04-16