Incidental Mutation 'R2960:Lexm'
ID255873
Institutional Source Beutler Lab
Gene Symbol Lexm
Ensembl Gene ENSMUSG00000054362
Gene Namelymphocyte expansion molecule
SynonymsBC055111
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R2960 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location106590909-106617241 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106613418 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 186 (S186P)
Ref Sequence ENSEMBL: ENSMUSP00000139868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067387] [ENSMUST00000106788] [ENSMUST00000189032]
Predicted Effect probably damaging
Transcript: ENSMUST00000067387
AA Change: S186P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066732
Gene: ENSMUSG00000054362
AA Change: S186P

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 63 83 1.3e-2 PFAM
Pfam:SHIPPO-rpt 119 152 3.5e-4 PFAM
low complexity region 157 173 N/A INTRINSIC
Pfam:SHIPPO-rpt 205 240 4.3e-3 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106788
AA Change: S186P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102400
Gene: ENSMUSG00000054362
AA Change: S186P

DomainStartEndE-ValueType
internal_repeat_1 62 146 2.56e-5 PROSPERO
low complexity region 157 173 N/A INTRINSIC
internal_repeat_1 204 279 2.56e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000189032
AA Change: S186P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139868
Gene: ENSMUSG00000054362
AA Change: S186P

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 63 83 1.3e-2 PFAM
Pfam:SHIPPO-rpt 119 152 3.5e-4 PFAM
low complexity region 157 173 N/A INTRINSIC
Pfam:SHIPPO-rpt 205 240 4.3e-3 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Heterozygous null mice show decreased CD8-positive, alpha-beta T cell number and decreased cytotoxic T cell cytolysis in response to lymphocytic choriomeningitis virus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl5c A G 11: 97,995,076 L33P probably damaging Het
Auh A T 13: 52,839,574 I268N probably damaging Het
Defa25 A T 8: 21,085,257 H84L probably benign Het
E130309D02Rik A T 5: 143,308,021 F234I probably benign Het
Endou T C 15: 97,713,806 Y317C probably damaging Het
Fmn2 C T 1: 174,609,819 L1119F probably damaging Het
Glyat T A 19: 12,639,850 L22H probably damaging Het
Gpd2 C T 2: 57,338,975 R264* probably null Het
Grb7 C T 11: 98,452,261 T268I probably damaging Het
Itfg2 G A 6: 128,413,552 A190V probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Mdga2 G T 12: 66,629,978 Y513* probably null Het
Med8 A G 4: 118,414,747 T222A probably damaging Het
Nup43 T C 10: 7,670,949 V111A probably benign Het
Olfr1410 A G 1: 92,608,328 I164V probably benign Het
Rfx3 G A 19: 27,900,811 Q29* probably null Het
Rfx8 A G 1: 39,682,952 V291A probably damaging Het
Scnn1a A G 6: 125,322,293 Y112C probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tmx3 T C 18: 90,532,992 V252A probably damaging Het
Vmn1r216 A G 13: 23,099,933 D262G probably benign Het
Vmn1r9 A G 6: 57,071,672 D244G possibly damaging Het
Xkr6 T A 14: 63,607,137 M203K possibly damaging Het
Zfr G A 15: 12,162,233 R823H probably benign Het
Other mutations in Lexm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02576:Lexm APN 4 106591628 missense possibly damaging 0.86
IGL02583:Lexm APN 4 106611405 splice site probably benign
IGL03329:Lexm APN 4 106607404 missense possibly damaging 0.92
R0294:Lexm UTSW 4 106613164 missense probably damaging 1.00
R1875:Lexm UTSW 4 106613256 splice site probably benign
R4654:Lexm UTSW 4 106610415 missense probably benign 0.03
R4836:Lexm UTSW 4 106610527 critical splice acceptor site probably null
R5436:Lexm UTSW 4 106610493 missense probably benign 0.00
R6086:Lexm UTSW 4 106613206 missense probably damaging 1.00
R6580:Lexm UTSW 4 106611514 missense possibly damaging 0.73
R6952:Lexm UTSW 4 106610399 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCACAAAGGTCTCAAGATCGC -3'
(R):5'- CCTTCTTGAGATCTGAAACCCC -3'

Sequencing Primer
(F):5'- CACAAAGGTCTCAAGATCGCTTTTG -3'
(R):5'- CCAAACATGTCTTCCTCAGATG -3'
Posted On2014-12-29