Incidental Mutation 'R2960:Nup43'
ID255883
Institutional Source Beutler Lab
Gene Symbol Nup43
Ensembl Gene ENSMUSG00000040034
Gene Namenucleoporin 43
Synonymsp42, 43kDa, 2610529I12Rik, 2610016K01Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R2960 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location7667503-7678881 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7670949 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 111 (V111A)
Ref Sequence ENSEMBL: ENSMUSP00000046732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040135] [ENSMUST00000159977] [ENSMUST00000162682]
Predicted Effect probably benign
Transcript: ENSMUST00000040135
AA Change: V111A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000046732
Gene: ENSMUSG00000040034
AA Change: V111A

DomainStartEndE-ValueType
Blast:WD40 1 48 1e-15 BLAST
WD40 64 101 3.57e0 SMART
WD40 124 157 2.45e2 SMART
WD40 160 199 9.55e0 SMART
WD40 206 246 2.15e-4 SMART
WD40 250 290 2.19e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161060
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162527
Predicted Effect probably benign
Transcript: ENSMUST00000162682
SMART Domains Protein: ENSMUSP00000124246
Gene: ENSMUSG00000019795

DomainStartEndE-ValueType
Pfam:PCMT 1 66 7.5e-26 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Bidirectional transport of macromolecules between the cytoplasm and nucleus occurs through nuclear pore complexes (NPCs) embedded in the nuclear envelope. NPCs are composed of subcomplexes, and NUP43 is part of one such subcomplex, Nup107-160 (Loiodice et al., 2004 [PubMed 15146057]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl5c A G 11: 97,995,076 L33P probably damaging Het
Auh A T 13: 52,839,574 I268N probably damaging Het
Defa25 A T 8: 21,085,257 H84L probably benign Het
E130309D02Rik A T 5: 143,308,021 F234I probably benign Het
Endou T C 15: 97,713,806 Y317C probably damaging Het
Fmn2 C T 1: 174,609,819 L1119F probably damaging Het
Glyat T A 19: 12,639,850 L22H probably damaging Het
Gpd2 C T 2: 57,338,975 R264* probably null Het
Grb7 C T 11: 98,452,261 T268I probably damaging Het
Itfg2 G A 6: 128,413,552 A190V probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lexm A G 4: 106,613,418 S186P probably damaging Het
Mdga2 G T 12: 66,629,978 Y513* probably null Het
Med8 A G 4: 118,414,747 T222A probably damaging Het
Olfr1410 A G 1: 92,608,328 I164V probably benign Het
Rfx3 G A 19: 27,900,811 Q29* probably null Het
Rfx8 A G 1: 39,682,952 V291A probably damaging Het
Scnn1a A G 6: 125,322,293 Y112C probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tmx3 T C 18: 90,532,992 V252A probably damaging Het
Vmn1r216 A G 13: 23,099,933 D262G probably benign Het
Vmn1r9 A G 6: 57,071,672 D244G possibly damaging Het
Xkr6 T A 14: 63,607,137 M203K possibly damaging Het
Zfr G A 15: 12,162,233 R823H probably benign Het
Other mutations in Nup43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Nup43 APN 10 7669556 missense probably benign
IGL02029:Nup43 APN 10 7667583 missense possibly damaging 0.87
IGL02375:Nup43 APN 10 7673594 missense probably damaging 1.00
R0413:Nup43 UTSW 10 7671027 missense probably benign 0.05
R1061:Nup43 UTSW 10 7667671 missense probably damaging 0.99
R1892:Nup43 UTSW 10 7673609 missense probably damaging 0.99
R3551:Nup43 UTSW 10 7675014 missense possibly damaging 0.93
R4772:Nup43 UTSW 10 7678669 nonsense probably null
R6179:Nup43 UTSW 10 7678673 missense probably benign 0.40
R6346:Nup43 UTSW 10 7675062 missense probably damaging 1.00
R8073:Nup43 UTSW 10 7670949 missense probably benign
R8220:Nup43 UTSW 10 7676333 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGGGAGACTTGTTCTTTCTTCTAC -3'
(R):5'- TGCCAAGTGTCATTTTCACACC -3'

Sequencing Primer
(F):5'- TTGTTCTTTCTTCTACAAGGACATG -3'
(R):5'- AATAGGACTCCTCACCTATAGTTCTG -3'
Posted On2014-12-29