Mutagenetix > Incidental Mutation

Incidental Mutation 'R2960:Mdga2'

255888

Institutional Source

Beutler Lab

Gene Symbol

Mdga2

Ensembl Gene

ENSMUSG00000034912

Gene Name

MAM domain containing glycosylphosphatidylinositol anchor 2

Synonyms

Adp, 6720489L24Rik, Mamdc1, 9330209L04Rik, Mdga2

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2960 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

66466060-67222549 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 66629978 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 513 (Y513*)

Ref Sequence

ENSEMBL: ENSMUSP00000152613 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037181] [ENSMUST00000222167] [ENSMUST00000223141]

AlphaFold

P60755

Predicted Effect

probably null
Transcript: ENSMUST00000037181
AA Change: Y582*

SMART Domains

Protein: ENSMUSP00000046761
Gene: ENSMUSG00000034912
AA Change: Y582*

Domain	Start	End	E-Value	Type
IGc2	122	186	1.38e-15	SMART
IG	213	307	1.79e0	SMART
IGc2	324	386	1.56e-14	SMART
IGc2	419	493	4.43e-5	SMART
low complexity region	495	507	N/A	INTRINSIC
IGc2	525	591	1.97e-11	SMART
IG_like	621	687	2.5e0	SMART
Blast:FN3	707	795	4e-40	BLAST
MAM	812	990	3.4e-49	SMART
transmembrane domain	999	1021	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000101379

SMART Domains

Protein: ENSMUSP00000098930
Gene: ENSMUSG00000034912

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
SCOP:d1cs6a1	40	72	2e-5	SMART
Blast:IG	47	72	9e-11	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000178814
AA Change: Y572*

SMART Domains

Protein: ENSMUSP00000137608
Gene: ENSMUSG00000034912
AA Change: Y572*

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
IGc2	53	117	1.38e-15	SMART
IG	144	238	1.79e0	SMART
IGc2	255	317	1.56e-14	SMART
IGc2	350	424	4.43e-5	SMART
low complexity region	426	438	N/A	INTRINSIC
IGc2	456	522	1.97e-11	SMART
IG_like	552	618	2.5e0	SMART
Blast:FN3	638	726	3e-40	BLAST
MAM	736	914	1.38e-49	SMART
transmembrane domain	923	945	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000179729

Predicted Effect

probably null
Transcript: ENSMUST00000222167
AA Change: Y513*

Predicted Effect

probably null
Transcript: ENSMUST00000223141
AA Change: Y513*

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223289

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice that paternally inherit an allele disrupted by transgene insertion exhibit varying degrees of abnormalities in the skull, paw, and tail. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 24 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arl5c	A	G	11: 97,995,076	L33P	probably damaging	Het
Auh	A	T	13: 52,839,574	I268N	probably damaging	Het
Defa25	A	T	8: 21,085,257	H84L	probably benign	Het
E130309D02Rik	A	T	5: 143,308,021	F234I	probably benign	Het
Endou	T	C	15: 97,713,806	Y317C	probably damaging	Het
Fmn2	C	T	1: 174,609,819	L1119F	probably damaging	Het
Glyat	T	A	19: 12,639,850	L22H	probably damaging	Het
Gpd2	C	T	2: 57,338,975	R264*	probably null	Het
Grb7	C	T	11: 98,452,261	T268I	probably damaging	Het
Itfg2	G	A	6: 128,413,552	A190V	probably benign	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Lexm	A	G	4: 106,613,418	S186P	probably damaging	Het
Med8	A	G	4: 118,414,747	T222A	probably damaging	Het
Nup43	T	C	10: 7,670,949	V111A	probably benign	Het
Olfr1410	A	G	1: 92,608,328	I164V	probably benign	Het
Rfx3	G	A	19: 27,900,811	Q29*	probably null	Het
Rfx8	A	G	1: 39,682,952	V291A	probably damaging	Het
Scnn1a	A	G	6: 125,322,293	Y112C	probably damaging	Het
Tex11	C	A	X: 100,933,415	A487S	possibly damaging	Het
Tmx3	T	C	18: 90,532,992	V252A	probably damaging	Het
Vmn1r216	A	G	13: 23,099,933	D262G	probably benign	Het
Vmn1r9	A	G	6: 57,071,672	D244G	possibly damaging	Het
Xkr6	T	A	14: 63,607,137	M203K	possibly damaging	Het
Zfr	G	A	15: 12,162,233	R823H	probably benign	Het

Other mutations in Mdga2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01343:Mdga2	APN	12	66723109	missense	probably damaging	0.97
IGL01632:Mdga2	APN	12	66629898	splice site	probably benign
IGL01843:Mdga2	APN	12	66723131	critical splice acceptor site	probably null
IGL02230:Mdga2	APN	12	66655423	nonsense	probably null
IGL02348:Mdga2	APN	12	66550575	missense	probably damaging	1.00
IGL02473:Mdga2	APN	12	66550611	missense	possibly damaging	0.73
IGL02795:Mdga2	APN	12	66689432	missense	probably benign	0.00
IGL02901:Mdga2	APN	12	66797809	splice site	probably benign
IGL03373:Mdga2	APN	12	66716722	missense	probably damaging	0.99
PIT4362001:Mdga2	UTSW	12	66797768	missense	possibly damaging	0.83
PIT4377001:Mdga2	UTSW	12	66716695	missense	probably damaging	0.99
R0106:Mdga2	UTSW	12	66716706	missense	probably damaging	1.00
R0106:Mdga2	UTSW	12	66716706	missense	probably damaging	1.00
R0110:Mdga2	UTSW	12	66470926	missense	possibly damaging	0.66
R0218:Mdga2	UTSW	12	66655120	missense	probably damaging	1.00
R0450:Mdga2	UTSW	12	66470926	missense	possibly damaging	0.66
R0801:Mdga2	UTSW	12	66486733	missense	probably damaging	1.00
R0847:Mdga2	UTSW	12	66723080	missense	probably damaging	1.00
R1056:Mdga2	UTSW	12	66723120	missense	probably damaging	0.97
R1086:Mdga2	UTSW	12	66506102	splice site	probably benign
R1335:Mdga2	UTSW	12	66716742	splice site	probably null
R1382:Mdga2	UTSW	12	66470916	missense	possibly damaging	0.68
R1490:Mdga2	UTSW	12	66797756	missense	probably benign	0.01
R1521:Mdga2	UTSW	12	66568926	missense	probably benign	0.00
R1556:Mdga2	UTSW	12	66550593	missense	possibly damaging	0.92
R1676:Mdga2	UTSW	12	66568772	missense	probably damaging	1.00
R1676:Mdga2	UTSW	12	66568773	nonsense	probably null
R1698:Mdga2	UTSW	12	66689335	missense	probably damaging	0.97
R1954:Mdga2	UTSW	12	66486708	splice site	probably benign
R2069:Mdga2	UTSW	12	66568917	nonsense	probably null
R2077:Mdga2	UTSW	12	66655362	missense	probably damaging	1.00
R2118:Mdga2	UTSW	12	66868752	missense	probably damaging	1.00
R2146:Mdga2	UTSW	12	66868741	missense	probably damaging	1.00
R2158:Mdga2	UTSW	12	66689381	missense	possibly damaging	0.64
R2189:Mdga2	UTSW	12	66473196	splice site	probably null
R2293:Mdga2	UTSW	12	66568985	nonsense	probably null
R2886:Mdga2	UTSW	12	66506270	splice site	probably benign
R3937:Mdga2	UTSW	12	67221206	unclassified	probably benign
R4437:Mdga2	UTSW	12	66473198	splice site	probably null
R4514:Mdga2	UTSW	12	66716722	missense	probably damaging	0.99
R4693:Mdga2	UTSW	12	66797633	missense	possibly damaging	0.81
R4719:Mdga2	UTSW	12	66471001	unclassified	probably benign
R4744:Mdga2	UTSW	12	66797727	missense	probably benign	0.01
R4756:Mdga2	UTSW	12	66797653	missense	probably damaging	1.00
R4781:Mdga2	UTSW	12	66797622	splice site	probably null
R5022:Mdga2	UTSW	12	66470760	missense	possibly damaging	0.83
R5108:Mdga2	UTSW	12	66486741	missense	probably benign	0.43
R5479:Mdga2	UTSW	12	66655176	missense	probably damaging	1.00
R5710:Mdga2	UTSW	12	66506782	missense	probably damaging	1.00
R5816:Mdga2	UTSW	12	66655182	missense	probably damaging	1.00
R5822:Mdga2	UTSW	12	66655335	missense	probably damaging	1.00
R5996:Mdga2	UTSW	12	66797763	missense	probably benign	0.00
R6038:Mdga2	UTSW	12	66630053	missense	probably damaging	1.00
R6038:Mdga2	UTSW	12	66630053	missense	probably damaging	1.00
R6297:Mdga2	UTSW	12	66506253	missense	probably damaging	1.00
R6484:Mdga2	UTSW	12	66630069	missense	possibly damaging	0.90
R6830:Mdga2	UTSW	12	66723001	missense	probably damaging	1.00
R6912:Mdga2	UTSW	12	66506115	missense	probably benign	0.01
R6971:Mdga2	UTSW	12	66550561	missense	probably damaging	1.00
R7053:Mdga2	UTSW	12	66689384	missense	probably benign	0.41
R7069:Mdga2	UTSW	12	66486752	missense	probably benign	0.31
R7381:Mdga2	UTSW	12	66568896	missense	probably benign	0.44
R7474:Mdga2	UTSW	12	66486761	nonsense	probably null
R7559:Mdga2	UTSW	12	66473229	missense	probably damaging	1.00
R7581:Mdga2	UTSW	12	66506255	missense	probably damaging	0.99
R7596:Mdga2	UTSW	12	66506123	missense	probably damaging	0.99
R7745:Mdga2	UTSW	12	66689350	missense	probably damaging	0.99
R7745:Mdga2	UTSW	12	66689351	missense	possibly damaging	0.63
R7852:Mdga2	UTSW	12	66470950	missense	possibly damaging	0.66
R8144:Mdga2	UTSW	12	66655263	missense	probably damaging	1.00
R8319:Mdga2	UTSW	12	67221029	missense	unknown
R8715:Mdga2	UTSW	12	66868752	missense	probably damaging	1.00
R8977:Mdga2	UTSW	12	66797635	missense	possibly damaging	0.88
R9138:Mdga2	UTSW	12	66568889	missense	possibly damaging	0.89
R9177:Mdga2	UTSW	12	66470707	missense	possibly damaging	0.66
R9223:Mdga2	UTSW	12	66568860	missense	possibly damaging	0.81
R9248:Mdga2	UTSW	12	66689452	missense	possibly damaging	0.87
R9264:Mdga2	UTSW	12	66513283	missense	probably damaging	1.00
R9381:Mdga2	UTSW	12	66550530	missense	possibly damaging	0.64
R9456:Mdga2	UTSW	12	66568758	missense	probably benign	0.44
R9633:Mdga2	UTSW	12	66689432	missense	probably benign	0.00
Z1176:Mdga2	UTSW	12	66689443	missense	probably damaging	1.00
Z1186:Mdga2	UTSW	12	66568953	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- ACTGCCATTAGATTTCGACAGC -3'
(R):5'- CCTTTGGTCACCAGAGAAGG -3'

Sequencing Primer
(F):5'- CTGCCATTAGATTTCGACAGCAATTG -3'
(R):5'- GAGACACAATAGAACTTCAGTGTC -3'

Posted On

2014-12-29