Incidental Mutation 'R0319:Malt1'
ID25589
Institutional Source Beutler Lab
Gene Symbol Malt1
Ensembl Gene ENSMUSG00000032688
Gene NameMALT1 paracaspase
Synonymsparacaspase, D430033E09Rik
MMRRC Submission 038529-MU
Accession Numbers

Genbank: NM_172833

Is this an essential gene? Possibly non essential (E-score: 0.453) question?
Stock #R0319 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location65430962-65478823 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 65462915 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049248] [ENSMUST00000224056]
Predicted Effect probably null
Transcript: ENSMUST00000049248
SMART Domains Protein: ENSMUSP00000048376
Gene: ENSMUSG00000032688

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
low complexity region 38 51 N/A INTRINSIC
PDB:2G7R|B 52 132 3e-29 PDB
IGc2 145 203 8.19e-9 SMART
IGc2 248 306 2.88e-4 SMART
Pfam:Peptidase_C14 340 557 1.4e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000224056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224265
Meta Mutation Damage Score 0.9500 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 95.0%
  • 20x: 89.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene has been found to be recurrently rearranged in chromosomal translocation with two other genes - baculoviral IAP repeat-containing protein 3 (also known as apoptosis inhibitor 2) and immunoglobulin heavy chain locus - in mucosa-associated lymphoid tissue lymphomas. The protein encoded by this gene may play a role in NF-kappaB activation. Two alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene disrupts normal B cell development and leads to impaired cytokine production and T cell and B cell proliferative responses after antigen receptor engagement due to failure of NF-kappaB activation. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A C 7: 128,237,190 V77G probably benign Het
Abcb1b A G 5: 8,827,428 R663G probably benign Het
Acly A G 11: 100,504,982 V404A probably damaging Het
Actg2 T A 6: 83,520,743 I103F probably damaging Het
Anapc5 A G 5: 122,818,856 V120A probably damaging Het
Ankk1 T G 9: 49,416,071 T603P probably damaging Het
Ankmy2 T C 12: 36,165,899 S33P possibly damaging Het
Arhgef19 A T 4: 141,256,399 T748S possibly damaging Het
Atad5 T A 11: 80,120,790 probably benign Het
Atxn10 T C 15: 85,365,282 L105P probably damaging Het
Cacna1s T C 1: 136,070,717 V161A probably damaging Het
Col6a3 T C 1: 90,807,704 E741G possibly damaging Het
Cpne9 G A 6: 113,294,693 G338E probably damaging Het
Cyp3a13 G A 5: 137,898,862 P397S probably damaging Het
Dbn1 C T 13: 55,474,916 E585K probably damaging Het
Dirc2 T C 16: 35,750,514 D140G probably benign Het
Draxin A G 4: 148,115,972 L7P probably benign Het
Exosc7 T A 9: 123,130,960 probably benign Het
Far2 A G 6: 148,157,470 E218G probably damaging Het
Ggps1 A C 13: 14,053,877 N240K possibly damaging Het
Kcnip1 T C 11: 33,651,529 probably benign Het
Kcnv2 A T 19: 27,324,024 Y425F probably benign Het
Kdelr2 T A 5: 143,412,517 F40I probably damaging Het
Kdm1b C T 13: 47,053,719 P173L probably benign Het
Kif20b G A 19: 34,947,732 probably benign Het
Klhl9 A T 4: 88,720,454 Y517N possibly damaging Het
Lgals3bp A G 11: 118,393,521 S411P probably damaging Het
Lmo3 G A 6: 138,377,311 T85M probably damaging Het
Lvrn C A 18: 46,864,753 T256N probably damaging Het
Mgst1 A G 6: 138,156,157 I157V possibly damaging Het
Mob3a A T 10: 80,689,985 V164E possibly damaging Het
Mprip T A 11: 59,697,038 probably benign Het
Mst1 A G 9: 108,082,513 N276S probably benign Het
Olfr1437 A T 19: 12,322,316 C170* probably null Het
P3h2 T A 16: 25,970,931 I529F possibly damaging Het
Pikfyve T A 1: 65,246,331 S865T probably benign Het
Rcbtb2 G A 14: 73,178,469 R474Q probably benign Het
Rpl27 G A 11: 101,443,495 probably benign Het
Rtp1 G A 16: 23,431,460 E192K probably damaging Het
Sgk2 T C 2: 162,995,672 probably benign Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Spdl1 T C 11: 34,823,520 N114S possibly damaging Het
Syne2 C T 12: 76,064,162 R5756W probably damaging Het
Tor1aip1 T C 1: 156,007,181 E307G probably damaging Het
Tpd52 T C 3: 8,953,689 T44A probably benign Het
Trim67 A T 8: 124,823,227 Y532F probably damaging Het
Ttll9 C A 2: 153,000,098 probably null Het
Ush2a T C 1: 188,948,374 probably benign Het
Vcam1 T C 3: 116,116,060 I539M probably benign Het
Vmn1r19 T A 6: 57,404,615 M51K possibly damaging Het
Vmn2r61 T A 7: 42,300,517 M787K probably damaging Het
Xdh T A 17: 73,906,101 probably benign Het
Zfp109 A T 7: 24,234,470 V8E probably damaging Het
Zfp595 G A 13: 67,316,513 A562V possibly damaging Het
Zfp759 A G 13: 67,140,292 T636A probably benign Het
Other mutations in Malt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Malt1 APN 18 65448963 nonsense probably null
IGL01354:Malt1 APN 18 65475191 missense probably damaging 1.00
IGL01514:Malt1 APN 18 65476400 missense possibly damaging 0.74
IGL01968:Malt1 APN 18 65449016 missense probably benign 0.08
bryce_canyon UTSW 18 65462915 critical splice donor site probably null
frappe UTSW 18 65473119 missense probably benign 0.01
mousebird UTSW 18 65475260 critical splice donor site probably null
yellowstone UTSW 18 65458200 missense probably damaging 1.00
H8930:Malt1 UTSW 18 65462815 nonsense probably null
R0512:Malt1 UTSW 18 65458200 missense probably damaging 1.00
R0748:Malt1 UTSW 18 65475260 critical splice donor site probably null
R2085:Malt1 UTSW 18 65473147 missense probably damaging 1.00
R2962:Malt1 UTSW 18 65448335 missense probably benign 0.01
R4193:Malt1 UTSW 18 65447675 missense probably benign 0.00
R4359:Malt1 UTSW 18 65476229 missense probably benign 0.00
R4913:Malt1 UTSW 18 65476280 missense probably damaging 1.00
R5201:Malt1 UTSW 18 65476055 missense probably benign
R5925:Malt1 UTSW 18 65431368 missense possibly damaging 0.86
R6944:Malt1 UTSW 18 65437920 missense probably benign 0.08
R7108:Malt1 UTSW 18 65464051 missense probably damaging 1.00
R7184:Malt1 UTSW 18 65447693 missense probably benign
R7192:Malt1 UTSW 18 65437827 missense probably benign 0.07
R7307:Malt1 UTSW 18 65451569 missense possibly damaging 0.48
R7308:Malt1 UTSW 18 65449609 critical splice donor site probably null
R7490:Malt1 UTSW 18 65448211 missense probably benign 0.04
R7558:Malt1 UTSW 18 65462834 missense probably damaging 1.00
R7756:Malt1 UTSW 18 65473119 missense probably benign 0.01
R7758:Malt1 UTSW 18 65473119 missense probably benign 0.01
R7892:Malt1 UTSW 18 65464116 critical splice donor site probably null
R8112:Malt1 UTSW 18 65449609 critical splice donor site probably null
Z1177:Malt1 UTSW 18 65431373 missense probably damaging 1.00
Z1177:Malt1 UTSW 18 65448284 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGATTGTTATATTATGCAGGGCACGG -3'
(R):5'- ACTGCTAGTCACATGGACATGGACTC -3'

Sequencing Primer
(F):5'- GGCACGGTTATGAAAACTTTGG -3'
(R):5'- TATAACTTGTACCTTTCACAGCAAAC -3'
Posted On2013-04-16