Incidental Mutation 'R2960:Auh'
ID 255891
Institutional Source Beutler Lab
Gene Symbol Auh
Ensembl Gene ENSMUSG00000021460
Gene Name AU RNA binding protein/enoyl-coenzyme A hydratase
Synonyms W91705
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2960 (G1)
Quality Score 200
Status Not validated
Chromosome 13
Chromosomal Location 52835119-52929681 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 52839574 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 268 (I268N)
Ref Sequence ENSEMBL: ENSMUSP00000021913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021913] [ENSMUST00000123599]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000021913
AA Change: I268N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021913
Gene: ENSMUSG00000021460
AA Change: I268N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ECH_1 59 314 4.5e-62 PFAM
Pfam:ECH_2 64 248 1.6e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123599
SMART Domains Protein: ENSMUSP00000116179
Gene: ENSMUSG00000021460

DomainStartEndE-ValueType
Pfam:ECH_1 21 217 1.7e-48 PFAM
Pfam:ECH_2 25 211 9.8e-30 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000137064
AA Change: I194N
SMART Domains Protein: ENSMUSP00000121852
Gene: ENSMUSG00000021460
AA Change: I194N

DomainStartEndE-ValueType
Pfam:ECH_2 1 179 1.9e-28 PFAM
Pfam:ECH_1 1 236 1.1e-51 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes bifunctional mitochondrial protein that has both RNA-binding and hydratase activities. The encoded protein is a methylglutaconyl-CoA hydratase that catalyzes the hydration of 3-methylglutaconyl-CoA to 3-hydroxy-3-methyl-glutaryl-CoA, a critical step in the leucine degradation pathway. This protein also binds AU-rich elements (AREs) found in the 3' UTRs of rapidly decaying mRNAs including c-fos, c-myc and granulocyte/ macrophage colony stimulating factor. ARE elements are involved in directing RNA to rapid degradation and deadenylation. This protein is localizes to the mitochondrial matrix and the inner mitochondrial membrane and may be involved in mitochondrial protein synthesis. Mutations in this gene are the cause of 3-methylglutaconic aciduria, type I. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl5c A G 11: 97,995,076 L33P probably damaging Het
Defa25 A T 8: 21,085,257 H84L probably benign Het
E130309D02Rik A T 5: 143,308,021 F234I probably benign Het
Endou T C 15: 97,713,806 Y317C probably damaging Het
Fmn2 C T 1: 174,609,819 L1119F probably damaging Het
Glyat T A 19: 12,639,850 L22H probably damaging Het
Gpd2 C T 2: 57,338,975 R264* probably null Het
Grb7 C T 11: 98,452,261 T268I probably damaging Het
Itfg2 G A 6: 128,413,552 A190V probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lexm A G 4: 106,613,418 S186P probably damaging Het
Mdga2 G T 12: 66,629,978 Y513* probably null Het
Med8 A G 4: 118,414,747 T222A probably damaging Het
Nup43 T C 10: 7,670,949 V111A probably benign Het
Olfr1410 A G 1: 92,608,328 I164V probably benign Het
Rfx3 G A 19: 27,900,811 Q29* probably null Het
Rfx8 A G 1: 39,682,952 V291A probably damaging Het
Scnn1a A G 6: 125,322,293 Y112C probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tmx3 T C 18: 90,532,992 V252A probably damaging Het
Vmn1r216 A G 13: 23,099,933 D262G probably benign Het
Vmn1r9 A G 6: 57,071,672 D244G possibly damaging Het
Xkr6 T A 14: 63,607,137 M203K possibly damaging Het
Zfr G A 15: 12,162,233 R823H probably benign Het
Other mutations in Auh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Auh APN 13 52838102 missense probably damaging 1.00
IGL02108:Auh APN 13 52889097 splice site probably benign
IGL02613:Auh APN 13 52918999 critical splice donor site probably null
PIT4131001:Auh UTSW 13 52841010 missense probably damaging 1.00
R0046:Auh UTSW 13 52929385 splice site probably benign
R0741:Auh UTSW 13 52929602 missense possibly damaging 0.53
R1480:Auh UTSW 13 52835496 missense probably benign 0.00
R1515:Auh UTSW 13 52835496 missense probably benign 0.00
R1581:Auh UTSW 13 52835496 missense probably benign 0.00
R1609:Auh UTSW 13 52835496 missense probably benign 0.00
R1611:Auh UTSW 13 52835496 missense probably benign 0.00
R1723:Auh UTSW 13 52835496 missense probably benign 0.00
R1724:Auh UTSW 13 52835496 missense probably benign 0.00
R1725:Auh UTSW 13 52835496 missense probably benign 0.00
R1742:Auh UTSW 13 52835496 missense probably benign 0.00
R1883:Auh UTSW 13 52835496 missense probably benign 0.00
R1884:Auh UTSW 13 52835496 missense probably benign 0.00
R1919:Auh UTSW 13 52835496 missense probably benign 0.00
R2022:Auh UTSW 13 52835496 missense probably benign 0.00
R2071:Auh UTSW 13 52835496 missense probably benign 0.00
R2114:Auh UTSW 13 52835496 missense probably benign 0.00
R2147:Auh UTSW 13 52835496 missense probably benign 0.00
R2149:Auh UTSW 13 52835496 missense probably benign 0.00
R2429:Auh UTSW 13 52919016 missense probably damaging 1.00
R2508:Auh UTSW 13 52898719 nonsense probably null
R3787:Auh UTSW 13 52929457 missense possibly damaging 0.95
R4594:Auh UTSW 13 52912966 unclassified probably benign
R4989:Auh UTSW 13 52841029 missense probably damaging 1.00
R5863:Auh UTSW 13 52898658 missense probably benign 0.06
R6041:Auh UTSW 13 52919086 missense possibly damaging 0.71
R6425:Auh UTSW 13 52841044 missense probably damaging 1.00
R6430:Auh UTSW 13 52929410 missense probably benign 0.41
R6434:Auh UTSW 13 52929410 missense probably benign 0.41
R6664:Auh UTSW 13 52898667 missense probably damaging 0.99
R6865:Auh UTSW 13 52838129 missense probably damaging 1.00
R7615:Auh UTSW 13 52919013 missense probably benign 0.00
R8379:Auh UTSW 13 52909313 makesense probably null
R8774:Auh UTSW 13 52839595 missense probably benign 0.21
R8774-TAIL:Auh UTSW 13 52839595 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- GCTGATGACCTCACTAAAGCAATG -3'
(R):5'- CGCAGTTGAAGCTCAGATGATG -3'

Sequencing Primer
(F):5'- TGTCAAAAGGAACAAGGCTCC -3'
(R):5'- ATGAGTTTAGCATCTCAGCTGC -3'
Posted On 2014-12-29