Incidental Mutation 'R2960:Glyat'
ID255896
Institutional Source Beutler Lab
Gene Symbol Glyat
Ensembl Gene ENSMUSG00000063683
Gene Nameglycine-N-acyltransferase
SynonymsA330009E03Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2960 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location12633308-12653911 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12639850 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 22 (L22H)
Ref Sequence ENSEMBL: ENSMUSP00000043308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044976] [ENSMUST00000119960]
Predicted Effect probably damaging
Transcript: ENSMUST00000044976
AA Change: L22H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043308
Gene: ENSMUSG00000063683
AA Change: L22H

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 206 1.9e-90 PFAM
Pfam:Gly_acyl_tr_C 207 295 2.8e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119960
SMART Domains Protein: ENSMUSP00000114002
Gene: ENSMUSG00000063683

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 172 1.2e-91 PFAM
Pfam:Gly_acyl_tr_C 173 261 3.6e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123173
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155846
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157069
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The glycine-N-acyltransferase protein conjugates glycine with acyl-CoA substrates in the mitochondria. The protein is thought to be important in the detoxification of endogenous and xenobiotic acyl-CoA's. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl5c A G 11: 97,995,076 L33P probably damaging Het
Auh A T 13: 52,839,574 I268N probably damaging Het
Defa25 A T 8: 21,085,257 H84L probably benign Het
E130309D02Rik A T 5: 143,308,021 F234I probably benign Het
Endou T C 15: 97,713,806 Y317C probably damaging Het
Fmn2 C T 1: 174,609,819 L1119F probably damaging Het
Gpd2 C T 2: 57,338,975 R264* probably null Het
Grb7 C T 11: 98,452,261 T268I probably damaging Het
Itfg2 G A 6: 128,413,552 A190V probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lexm A G 4: 106,613,418 S186P probably damaging Het
Mdga2 G T 12: 66,629,978 Y513* probably null Het
Med8 A G 4: 118,414,747 T222A probably damaging Het
Nup43 T C 10: 7,670,949 V111A probably benign Het
Olfr1410 A G 1: 92,608,328 I164V probably benign Het
Rfx3 G A 19: 27,900,811 Q29* probably null Het
Rfx8 A G 1: 39,682,952 V291A probably damaging Het
Scnn1a A G 6: 125,322,293 Y112C probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tmx3 T C 18: 90,532,992 V252A probably damaging Het
Vmn1r216 A G 13: 23,099,933 D262G probably benign Het
Vmn1r9 A G 6: 57,071,672 D244G possibly damaging Het
Xkr6 T A 14: 63,607,137 M203K possibly damaging Het
Zfr G A 15: 12,162,233 R823H probably benign Het
Other mutations in Glyat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Glyat APN 19 12648133 splice site probably benign
IGL00766:Glyat APN 19 12651262 missense probably benign 0.19
IGL01288:Glyat APN 19 12650355 missense possibly damaging 0.56
IGL02296:Glyat APN 19 12651261 missense probably damaging 0.99
PIT4458001:Glyat UTSW 19 12648009 missense probably benign 0.34
R0416:Glyat UTSW 19 12651453 missense possibly damaging 0.87
R1463:Glyat UTSW 19 12648103 missense probably damaging 1.00
R1750:Glyat UTSW 19 12646315 missense probably benign 0.01
R2416:Glyat UTSW 19 12651254 missense possibly damaging 0.50
R2504:Glyat UTSW 19 12651398 missense possibly damaging 0.82
R3958:Glyat UTSW 19 12639833 missense probably benign 0.05
R4126:Glyat UTSW 19 12651479 missense probably benign 0.03
R4561:Glyat UTSW 19 12651280 missense possibly damaging 0.88
R4705:Glyat UTSW 19 12651297 missense possibly damaging 0.68
R5062:Glyat UTSW 19 12650263 missense probably damaging 1.00
R5490:Glyat UTSW 19 12650281 missense probably benign 0.35
R7028:Glyat UTSW 19 12650359 missense probably benign 0.00
R7044:Glyat UTSW 19 12650265 missense probably benign 0.05
R7599:Glyat UTSW 19 12639808 missense probably damaging 0.99
Z1088:Glyat UTSW 19 12648009 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTTCCTTGGAGCTGGTAAG -3'
(R):5'- AGTCACACAGCACATGCATG -3'

Sequencing Primer
(F):5'- CCTTGGAGCTGGTAAGAATGTTATAG -3'
(R):5'- TGCATATTCACATACTTCAGTCACAC -3'
Posted On2014-12-29