Incidental Mutation 'R2960:Tex11'
ID 255898
Institutional Source Beutler Lab
Gene Symbol Tex11
Ensembl Gene ENSMUSG00000009670
Gene Name testis expressed gene 11
Synonyms 4930565P14Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.178) question?
Stock # R2960 (G1)
Quality Score 222
Status Not validated
Chromosome X
Chromosomal Location 100838648-101059667 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 100933415 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 487 (A487S)
Ref Sequence ENSEMBL: ENSMUSP00000109347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009814] [ENSMUST00000113716] [ENSMUST00000113718]
AlphaFold Q14AT2
Predicted Effect possibly damaging
Transcript: ENSMUST00000009814
AA Change: A487S

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000009814
Gene: ENSMUSG00000009670
AA Change: A487S

DomainStartEndE-ValueType
Pfam:SPO22 176 431 1.1e-62 PFAM
low complexity region 702 713 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113716
AA Change: A487S

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109345
Gene: ENSMUSG00000009670
AA Change: A487S

DomainStartEndE-ValueType
Pfam:SPO22 175 433 2.1e-70 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113718
AA Change: A487S

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000109347
Gene: ENSMUSG00000009670
AA Change: A487S

DomainStartEndE-ValueType
Pfam:SPO22 175 433 3.8e-70 PFAM
low complexity region 702 713 N/A INTRINSIC
Meta Mutation Damage Score 0.3188 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is X-linked and is expressed in only male germ cells. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Miche homozygous for a knockout allele exhibit abnormal male meiosis. Mice homozygous for a conditional knockout exhibit male infertility and reduced female fecundity due to abnormal meiosis following cre recombination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl5c A G 11: 97,995,076 L33P probably damaging Het
Auh A T 13: 52,839,574 I268N probably damaging Het
Defa25 A T 8: 21,085,257 H84L probably benign Het
E130309D02Rik A T 5: 143,308,021 F234I probably benign Het
Endou T C 15: 97,713,806 Y317C probably damaging Het
Fmn2 C T 1: 174,609,819 L1119F probably damaging Het
Glyat T A 19: 12,639,850 L22H probably damaging Het
Gpd2 C T 2: 57,338,975 R264* probably null Het
Grb7 C T 11: 98,452,261 T268I probably damaging Het
Itfg2 G A 6: 128,413,552 A190V probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lexm A G 4: 106,613,418 S186P probably damaging Het
Mdga2 G T 12: 66,629,978 Y513* probably null Het
Med8 A G 4: 118,414,747 T222A probably damaging Het
Nup43 T C 10: 7,670,949 V111A probably benign Het
Olfr1410 A G 1: 92,608,328 I164V probably benign Het
Rfx3 G A 19: 27,900,811 Q29* probably null Het
Rfx8 A G 1: 39,682,952 V291A probably damaging Het
Scnn1a A G 6: 125,322,293 Y112C probably damaging Het
Tmx3 T C 18: 90,532,992 V252A probably damaging Het
Vmn1r216 A G 13: 23,099,933 D262G probably benign Het
Vmn1r9 A G 6: 57,071,672 D244G possibly damaging Het
Xkr6 T A 14: 63,607,137 M203K possibly damaging Het
Zfr G A 15: 12,162,233 R823H probably benign Het
Other mutations in Tex11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00536:Tex11 APN X 101032559 missense probably null 0.00
IGL00838:Tex11 APN X 100972118 missense possibly damaging 0.92
IGL02385:Tex11 APN X 100876529 splice site probably benign
R2958:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R2963:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R3008:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R3009:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R3010:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R3011:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R3745:Tex11 UTSW X 100916572 missense probably benign 0.33
R3881:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R3882:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4081:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4082:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4159:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4172:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4197:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4201:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4204:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4206:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4304:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R4305:Tex11 UTSW X 100933415 missense possibly damaging 0.70
R8726:Tex11 UTSW X 101015585 missense possibly damaging 0.82
R8727:Tex11 UTSW X 101015585 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GGCTCAAATGATGGTTTCCC -3'
(R):5'- GAGTACTCCTCAACAATTGTGTC -3'

Sequencing Primer
(F):5'- GCTCAAATGATGGTTTCCCGAATTC -3'
(R):5'- GCCATAGCAGAAGTTGAG -3'
Posted On 2014-12-29