Mutagenetix > Incidental Mutation

Incidental Mutation 'R2961:Gpd2'

255899

Institutional Source

Beutler Lab

Gene Symbol

Gpd2

Ensembl Gene

ENSMUSG00000026827

Gene Name

glycerol phosphate dehydrogenase 2, mitochondrial

Synonyms

Gdm1

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.697) question?

Stock #

R2961 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

57237635-57370719 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 57338975 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 264 (R264*)

Ref Sequence

ENSEMBL: ENSMUSP00000130992 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028167] [ENSMUST00000112618] [ENSMUST00000169687]

AlphaFold

Q64521

Predicted Effect

probably null
Transcript: ENSMUST00000028167
AA Change: R264*

SMART Domains

Protein: ENSMUSP00000028167
Gene: ENSMUSG00000026827
AA Change: R264*

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:FAD_binding_2	71	145	5.2e-7	PFAM
Pfam:FAD_oxidored	71	147	2.3e-9	PFAM
Pfam:DAO	71	441	8.9e-52	PFAM
EFh	627	655	1.38e1	SMART
EFh	663	691	1.27e-3	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000112618
AA Change: R264*

SMART Domains

Protein: ENSMUSP00000108237
Gene: ENSMUSG00000026827
AA Change: R264*

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:FAD_binding_2	71	143	4.6e-7	PFAM
Pfam:DAO	71	441	2.9e-50	PFAM
Pfam:DAO_C	462	588	2.1e-42	PFAM
EFh	645	673	1.38e1	SMART
EFh	681	709	1.27e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141536

Predicted Effect

probably null
Transcript: ENSMUST00000169687
AA Change: R264*

SMART Domains

Protein: ENSMUSP00000130992
Gene: ENSMUSG00000026827
AA Change: R264*

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:FAD_binding_2	71	145	5.2e-7	PFAM
Pfam:FAD_oxidored	71	147	2.3e-9	PFAM
Pfam:DAO	71	441	8.9e-52	PFAM
EFh	627	655	1.38e1	SMART
EFh	663	691	1.27e-3	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to the inner mitochondrial membrane and catalyzes the conversion of glycerol-3-phosphate to dihydroxyacetone phosphate, using FAD as a cofactor. Along with GDP1, the encoded protein constitutes the glycerol phosphate shuttle, which reoxidizes NADH formed during glycolysis. Two transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit diminished hepatic ATP levels, decreased adiposity and fasting blood glucose, and, on an inbred background, reductions in preweaning viability and fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 15 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akna	A	G	4: 63,394,944	V314A	probably benign	Het
Cdk5rap2	ATGTG	ATG	4: 70,289,977		probably null	Het
Cyp4a10	C	A	4: 115,520,270	A118E	probably benign	Het
Dpys	A	G	15: 39,784,614	M515T	probably benign	Het
Eri2	T	C	7: 119,785,344	T645A	probably benign	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Mmp27	G	T	9: 7,573,602	D232Y	probably damaging	Het
Mybpc1	T	C	10: 88,531,779	D876G	probably damaging	Het
Rin3	C	A	12: 102,313,046	S38*	probably null	Het
Sptb	T	C	12: 76,603,582	D1787G	probably benign	Het
Trbv13-2	A	T	6: 41,121,640	M50L	probably damaging	Het
Ubxn1	T	A	19: 8,873,803	V164D	probably damaging	Het
Zfp608	T	C	18: 54,898,472	T799A	possibly damaging	Het
Zfr	G	A	15: 12,162,233	R823H	probably benign	Het

Other mutations in Gpd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00946:Gpd2	APN	2	57268084	critical splice donor site	probably null
IGL01012:Gpd2	APN	2	57364530	missense	probably benign	0.00
IGL01096:Gpd2	APN	2	57338867	missense	probably damaging	0.98
IGL01642:Gpd2	APN	2	57268071	nonsense	probably null
IGL01816:Gpd2	APN	2	57364066	nonsense	probably null
IGL02257:Gpd2	APN	2	57364524	missense	probably benign	0.01
IGL02824:Gpd2	APN	2	57364327	missense	probably null	0.89
IGL02832:Gpd2	APN	2	57338979	missense	probably damaging	1.00
IGL03040:Gpd2	APN	2	57355793	missense	probably benign	0.06
IGL03107:Gpd2	APN	2	57355569	missense	probably damaging	1.00
IGL03131:Gpd2	APN	2	57338843	splice site	probably benign
IGL03218:Gpd2	APN	2	57307054	missense	probably damaging	1.00
IGL03226:Gpd2	APN	2	57304486	critical splice donor site	probably null
IGL03372:Gpd2	APN	2	57355507	missense	probably damaging	1.00
R0012:Gpd2	UTSW	2	57338868	missense	probably damaging	1.00
R0285:Gpd2	UTSW	2	57338955	missense	probably benign	0.16
R0379:Gpd2	UTSW	2	57345263	missense	probably damaging	1.00
R0401:Gpd2	UTSW	2	57340093	missense	possibly damaging	0.94
R1347:Gpd2	UTSW	2	57357671	missense	probably damaging	0.99
R1347:Gpd2	UTSW	2	57357671	missense	probably damaging	0.99
R1468:Gpd2	UTSW	2	57355774	missense	probably damaging	1.00
R1468:Gpd2	UTSW	2	57355774	missense	probably damaging	1.00
R1490:Gpd2	UTSW	2	57355475	missense	probably damaging	1.00
R1672:Gpd2	UTSW	2	57357700	missense	probably damaging	0.97
R1709:Gpd2	UTSW	2	57357655	missense	probably damaging	1.00
R1735:Gpd2	UTSW	2	57355551	missense	probably damaging	1.00
R2056:Gpd2	UTSW	2	57339013	critical splice donor site	probably null
R2959:Gpd2	UTSW	2	57338975	nonsense	probably null
R2960:Gpd2	UTSW	2	57338975	nonsense	probably null
R2962:Gpd2	UTSW	2	57338975	nonsense	probably null
R3008:Gpd2	UTSW	2	57338975	nonsense	probably null
R3009:Gpd2	UTSW	2	57338975	nonsense	probably null
R3881:Gpd2	UTSW	2	57338975	nonsense	probably null
R4073:Gpd2	UTSW	2	57290013	missense	probably damaging	1.00
R4153:Gpd2	UTSW	2	57355771	missense	probably damaging	1.00
R4564:Gpd2	UTSW	2	57307083	missense	possibly damaging	0.77
R4952:Gpd2	UTSW	2	57307013	nonsense	probably null
R5030:Gpd2	UTSW	2	57304405	missense	probably damaging	0.98
R5101:Gpd2	UTSW	2	57355901	missense	probably damaging	1.00
R5185:Gpd2	UTSW	2	57340204	missense	probably damaging	1.00
R6020:Gpd2	UTSW	2	57364513	missense	probably benign	0.18
R6325:Gpd2	UTSW	2	57304396	missense	probably damaging	0.96
R6536:Gpd2	UTSW	2	57345355	missense	probably benign	0.40
R6923:Gpd2	UTSW	2	57355788	missense	probably damaging	0.98
R7058:Gpd2	UTSW	2	57307100	splice site	probably null
R7380:Gpd2	UTSW	2	57340159	missense	probably damaging	1.00
R8052:Gpd2	UTSW	2	57306950	nonsense	probably null
R8098:Gpd2	UTSW	2	57290008	missense	possibly damaging	0.94
R8467:Gpd2	UTSW	2	57364584	missense	possibly damaging	0.95
R8851:Gpd2	UTSW	2	57307050	missense	possibly damaging	0.62
R9515:Gpd2	UTSW	2	57305854	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- TGTTGTGACACACTTCTGTACC -3'
(R):5'- ATGTTAAGCCAGGCATTGTTGAC -3'

Sequencing Primer
(F):5'- TGACACACTTCTGTACCACCCG -3'
(R):5'- GACTGAAGTCTGCCTTTC -3'

Posted On

2014-12-29