Incidental Mutation 'R0319:Kcnv2'
ID25591
Institutional Source Beutler Lab
Gene Symbol Kcnv2
Ensembl Gene ENSMUSG00000047298
Gene Namepotassium channel, subfamily V, member 2
SynonymsKV11.1
MMRRC Submission 038529-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0319 (G1)
Quality Score222
Status Validated
Chromosome19
Chromosomal Location27322588-27337179 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 27324024 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 425 (Y425F)
Ref Sequence ENSEMBL: ENSMUSP00000055091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056708]
Predicted Effect probably benign
Transcript: ENSMUST00000056708
AA Change: Y425F

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000055091
Gene: ENSMUSG00000047298
AA Change: Y425F

DomainStartEndE-ValueType
low complexity region 64 79 N/A INTRINSIC
Pfam:BTB_2 107 206 3.1e-22 PFAM
low complexity region 225 240 N/A INTRINSIC
Pfam:Ion_trans 269 521 2.2e-39 PFAM
Pfam:PKD_channel 305 516 2.5e-7 PFAM
Pfam:Ion_trans_2 430 515 2.2e-15 PFAM
Meta Mutation Damage Score 0.1735 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 95.0%
  • 20x: 89.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium voltage-gated channel subfamily V. This member is identified as a 'silent subunit', and it does not form homomultimers, but forms heteromultimers with several other subfamily members. Through obligatory heteromerization, it exerts a function-altering effect on other potassium channel subunits. This protein is strongly expressed in pancreas and has a weaker expression in several other tissues. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional ready allele are viable, fertile, and phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik A C 7: 128,237,190 V77G probably benign Het
Abcb1b A G 5: 8,827,428 R663G probably benign Het
Acly A G 11: 100,504,982 V404A probably damaging Het
Actg2 T A 6: 83,520,743 I103F probably damaging Het
Anapc5 A G 5: 122,818,856 V120A probably damaging Het
Ankk1 T G 9: 49,416,071 T603P probably damaging Het
Ankmy2 T C 12: 36,165,899 S33P possibly damaging Het
Arhgef19 A T 4: 141,256,399 T748S possibly damaging Het
Atad5 T A 11: 80,120,790 probably benign Het
Atxn10 T C 15: 85,365,282 L105P probably damaging Het
Cacna1s T C 1: 136,070,717 V161A probably damaging Het
Col6a3 T C 1: 90,807,704 E741G possibly damaging Het
Cpne9 G A 6: 113,294,693 G338E probably damaging Het
Cyp3a13 G A 5: 137,898,862 P397S probably damaging Het
Dbn1 C T 13: 55,474,916 E585K probably damaging Het
Dirc2 T C 16: 35,750,514 D140G probably benign Het
Draxin A G 4: 148,115,972 L7P probably benign Het
Exosc7 T A 9: 123,130,960 probably benign Het
Far2 A G 6: 148,157,470 E218G probably damaging Het
Ggps1 A C 13: 14,053,877 N240K possibly damaging Het
Kcnip1 T C 11: 33,651,529 probably benign Het
Kdelr2 T A 5: 143,412,517 F40I probably damaging Het
Kdm1b C T 13: 47,053,719 P173L probably benign Het
Kif20b G A 19: 34,947,732 probably benign Het
Klhl9 A T 4: 88,720,454 Y517N possibly damaging Het
Lgals3bp A G 11: 118,393,521 S411P probably damaging Het
Lmo3 G A 6: 138,377,311 T85M probably damaging Het
Lvrn C A 18: 46,864,753 T256N probably damaging Het
Malt1 T C 18: 65,462,915 probably null Het
Mgst1 A G 6: 138,156,157 I157V possibly damaging Het
Mob3a A T 10: 80,689,985 V164E possibly damaging Het
Mprip T A 11: 59,697,038 probably benign Het
Mst1 A G 9: 108,082,513 N276S probably benign Het
Olfr1437 A T 19: 12,322,316 C170* probably null Het
P3h2 T A 16: 25,970,931 I529F possibly damaging Het
Pikfyve T A 1: 65,246,331 S865T probably benign Het
Rcbtb2 G A 14: 73,178,469 R474Q probably benign Het
Rpl27 G A 11: 101,443,495 probably benign Het
Rtp1 G A 16: 23,431,460 E192K probably damaging Het
Sgk2 T C 2: 162,995,672 probably benign Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Spdl1 T C 11: 34,823,520 N114S possibly damaging Het
Syne2 C T 12: 76,064,162 R5756W probably damaging Het
Tor1aip1 T C 1: 156,007,181 E307G probably damaging Het
Tpd52 T C 3: 8,953,689 T44A probably benign Het
Trim67 A T 8: 124,823,227 Y532F probably damaging Het
Ttll9 C A 2: 153,000,098 probably null Het
Ush2a T C 1: 188,948,374 probably benign Het
Vcam1 T C 3: 116,116,060 I539M probably benign Het
Vmn1r19 T A 6: 57,404,615 M51K possibly damaging Het
Vmn2r61 T A 7: 42,300,517 M787K probably damaging Het
Xdh T A 17: 73,906,101 probably benign Het
Zfp109 A T 7: 24,234,470 V8E probably damaging Het
Zfp595 G A 13: 67,316,513 A562V possibly damaging Het
Zfp759 A G 13: 67,140,292 T636A probably benign Het
Other mutations in Kcnv2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03157:Kcnv2 APN 19 27323966 missense probably damaging 1.00
R0104:Kcnv2 UTSW 19 27323219 missense probably damaging 0.98
R2852:Kcnv2 UTSW 19 27323096 missense probably benign 0.13
R4578:Kcnv2 UTSW 19 27323594 missense probably benign 0.01
R4702:Kcnv2 UTSW 19 27323567 missense probably damaging 1.00
R4842:Kcnv2 UTSW 19 27323790 missense probably damaging 1.00
R4935:Kcnv2 UTSW 19 27322932 missense probably damaging 1.00
R6305:Kcnv2 UTSW 19 27323837 missense probably benign 0.01
R6577:Kcnv2 UTSW 19 27324020 missense possibly damaging 0.46
R6974:Kcnv2 UTSW 19 27333882 missense probably benign
R7113:Kcnv2 UTSW 19 27324048 missense probably damaging 1.00
R7289:Kcnv2 UTSW 19 27333684 missense probably damaging 1.00
R7838:Kcnv2 UTSW 19 27322932 missense probably damaging 1.00
R7936:Kcnv2 UTSW 19 27322767 missense probably benign 0.04
Z1176:Kcnv2 UTSW 19 27323438 missense probably benign 0.11
Z1177:Kcnv2 UTSW 19 27323241 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTTTCGGGACATGCGCTTCTATG -3'
(R):5'- TGCAGAAACCCAAGTGCCATGTTAC -3'

Sequencing Primer
(F):5'- TCAACCTAGTGGACCTGGTG -3'
(R):5'- AAGTGCCATGTTACTCACCG -3'
Posted On2013-04-16