Incidental Mutation 'R2961:Dpys'
ID 255913
Institutional Source Beutler Lab
Gene Symbol Dpys
Ensembl Gene ENSMUSG00000022304
Gene Name dihydropyrimidinase
Synonyms 1300004I01Rik, DHPase, 1200017I10Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock # R2961 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 39768487-39857470 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 39784614 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 515 (M515T)
Ref Sequence ENSEMBL: ENSMUSP00000105935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022915] [ENSMUST00000110306]
AlphaFold Q9EQF5
Predicted Effect probably benign
Transcript: ENSMUST00000022915
AA Change: M515T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022915
Gene: ENSMUSG00000022304
AA Change: M515T

DomainStartEndE-ValueType
Pfam:Amidohydro_1 58 447 1.2e-39 PFAM
Pfam:Amidohydro_3 310 448 6.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110306
AA Change: M515T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105935
Gene: ENSMUSG00000022304
AA Change: M515T

DomainStartEndE-ValueType
Pfam:Amidohydro_5 25 98 8.3e-14 PFAM
Pfam:Amidohydro_4 53 404 4e-22 PFAM
Pfam:Amidohydro_1 58 407 1e-26 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000155859
AA Change: M42T
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dihydropyrimidinase catalyzes the conversion of 5,6-dihydrouracil to 3-ureidopropionate in pyrimidine metabolism. Dihydropyrimidinase is expressed at a high level in liver and kidney as a major 2.5-kb transcript and a minor 3.8-kb transcript. Defects in the DPYS gene are linked to dihydropyrimidinuria. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 15 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akna A G 4: 63,394,944 V314A probably benign Het
Cdk5rap2 ATGTG ATG 4: 70,289,977 probably null Het
Cyp4a10 C A 4: 115,520,270 A118E probably benign Het
Eri2 T C 7: 119,785,344 T645A probably benign Het
Gpd2 C T 2: 57,338,975 R264* probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Mmp27 G T 9: 7,573,602 D232Y probably damaging Het
Mybpc1 T C 10: 88,531,779 D876G probably damaging Het
Rin3 C A 12: 102,313,046 S38* probably null Het
Sptb T C 12: 76,603,582 D1787G probably benign Het
Trbv13-2 A T 6: 41,121,640 M50L probably damaging Het
Ubxn1 T A 19: 8,873,803 V164D probably damaging Het
Zfp608 T C 18: 54,898,472 T799A possibly damaging Het
Zfr G A 15: 12,162,233 R823H probably benign Het
Other mutations in Dpys
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01015:Dpys APN 15 39846649 missense probably damaging 1.00
IGL01408:Dpys APN 15 39793306 missense possibly damaging 0.74
IGL02372:Dpys APN 15 39793271 missense probably benign 0.17
IGL02949:Dpys APN 15 39826883 missense probably damaging 0.97
IGL03357:Dpys APN 15 39824216 missense probably damaging 1.00
IGL02837:Dpys UTSW 15 39857305 missense probably damaging 1.00
PIT4468001:Dpys UTSW 15 39857205 missense probably damaging 0.96
R0315:Dpys UTSW 15 39857338 missense probably benign 0.01
R1252:Dpys UTSW 15 39824240 missense probably damaging 1.00
R2314:Dpys UTSW 15 39828090 missense possibly damaging 0.76
R2381:Dpys UTSW 15 39842054 missense probably damaging 1.00
R4653:Dpys UTSW 15 39793246 missense probably damaging 0.97
R4702:Dpys UTSW 15 39793402 missense possibly damaging 0.69
R4978:Dpys UTSW 15 39826936 missense possibly damaging 0.94
R5640:Dpys UTSW 15 39842066 missense probably damaging 1.00
R5714:Dpys UTSW 15 39857157 missense probably damaging 0.98
R5758:Dpys UTSW 15 39826999 missense possibly damaging 0.67
R6017:Dpys UTSW 15 39846718 missense probably null 0.04
R6482:Dpys UTSW 15 39841973 missense probably damaging 1.00
R6788:Dpys UTSW 15 39857163 missense probably damaging 1.00
R7090:Dpys UTSW 15 39826883 missense probably damaging 0.97
R7098:Dpys UTSW 15 39793331 missense probably damaging 1.00
R7869:Dpys UTSW 15 39793386 missense probably damaging 1.00
R8030:Dpys UTSW 15 39828090 missense possibly damaging 0.76
R8092:Dpys UTSW 15 39846614 missense probably benign 0.00
R8318:Dpys UTSW 15 39784665 missense probably benign
R8347:Dpys UTSW 15 39857313 missense probably benign 0.03
R8352:Dpys UTSW 15 39793324 missense possibly damaging 0.46
R8452:Dpys UTSW 15 39793324 missense possibly damaging 0.46
R8914:Dpys UTSW 15 39857223 missense probably benign
R9341:Dpys UTSW 15 39793352 missense possibly damaging 0.88
R9343:Dpys UTSW 15 39793352 missense possibly damaging 0.88
R9403:Dpys UTSW 15 39828071 missense probably damaging 1.00
R9473:Dpys UTSW 15 39824187 missense possibly damaging 0.82
Z1177:Dpys UTSW 15 39842099 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AGGCCTTTATCAGGGTTCCTTC -3'
(R):5'- ATAGGATGCCTGTGGTCACTC -3'

Sequencing Primer
(F):5'- ATCAGGGTTCCTTCTACTTTGAAG -3'
(R):5'- TGTGGTCACTCACAGAGTTAC -3'
Posted On 2014-12-29