Incidental Mutation 'R2962:Gpd2'
ID255916
Institutional Source Beutler Lab
Gene Symbol Gpd2
Ensembl Gene ENSMUSG00000026827
Gene Nameglycerol phosphate dehydrogenase 2, mitochondrial
SynonymsGdm1
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.535) question?
Stock #R2962 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location57237635-57370719 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 57338975 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 264 (R264*)
Ref Sequence ENSEMBL: ENSMUSP00000130992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028167] [ENSMUST00000112618] [ENSMUST00000169687]
Predicted Effect probably null
Transcript: ENSMUST00000028167
AA Change: R264*
SMART Domains Protein: ENSMUSP00000028167
Gene: ENSMUSG00000026827
AA Change: R264*

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:FAD_binding_2 71 145 5.2e-7 PFAM
Pfam:FAD_oxidored 71 147 2.3e-9 PFAM
Pfam:DAO 71 441 8.9e-52 PFAM
EFh 627 655 1.38e1 SMART
EFh 663 691 1.27e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112618
AA Change: R264*
SMART Domains Protein: ENSMUSP00000108237
Gene: ENSMUSG00000026827
AA Change: R264*

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:FAD_binding_2 71 143 4.6e-7 PFAM
Pfam:DAO 71 441 2.9e-50 PFAM
Pfam:DAO_C 462 588 2.1e-42 PFAM
EFh 645 673 1.38e1 SMART
EFh 681 709 1.27e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141536
Predicted Effect probably null
Transcript: ENSMUST00000169687
AA Change: R264*
SMART Domains Protein: ENSMUSP00000130992
Gene: ENSMUSG00000026827
AA Change: R264*

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:FAD_binding_2 71 145 5.2e-7 PFAM
Pfam:FAD_oxidored 71 147 2.3e-9 PFAM
Pfam:DAO 71 441 8.9e-52 PFAM
EFh 627 655 1.38e1 SMART
EFh 663 691 1.27e-3 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to the inner mitochondrial membrane and catalyzes the conversion of glycerol-3-phosphate to dihydroxyacetone phosphate, using FAD as a cofactor. Along with GDP1, the encoded protein constitutes the glycerol phosphate shuttle, which reoxidizes NADH formed during glycolysis. Two transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit diminished hepatic ATP levels, decreased adiposity and fasting blood glucose, and, on an inbred background, reductions in preweaning viability and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cd24a A G 10: 43,579,317 T22A probably benign Het
Cdk5rap2 ATGTG ATG 4: 70,289,977 probably null Het
Cog3 A G 14: 75,740,534 probably null Het
Gm3371 A T 14: 44,408,698 N103K probably benign Het
Hoxc10 A G 15: 102,967,300 Y148C probably damaging Het
Jade1 C G 3: 41,613,327 T610S probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Malt1 A G 18: 65,448,335 H278R probably benign Het
Mlxip C A 5: 123,440,824 R178S probably damaging Het
Olfr539 A T 7: 140,667,949 M214L probably benign Het
Pdxk A G 10: 78,443,833 L236P probably damaging Het
Plekhg3 G A 12: 76,572,659 probably null Het
Rufy2 G T 10: 63,000,260 V323F probably damaging Het
Serpinb7 A G 1: 107,451,726 T288A probably benign Het
Tet1 A T 10: 62,814,544 C1628* probably null Het
Tgtp2 A G 11: 49,059,536 S70P probably damaging Het
Tmem211 T C 5: 113,238,056 V123A possibly damaging Het
Trank1 C T 9: 111,352,080 T390I probably damaging Het
Trim31 T C 17: 36,899,904 S143P probably damaging Het
Ube3c C A 5: 29,658,418 A897D possibly damaging Het
Unc79 A T 12: 103,095,119 T1050S possibly damaging Het
Zfr G A 15: 12,162,233 R823H probably benign Het
Other mutations in Gpd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Gpd2 APN 2 57268084 critical splice donor site probably null
IGL01012:Gpd2 APN 2 57364530 missense probably benign 0.00
IGL01096:Gpd2 APN 2 57338867 missense probably damaging 0.98
IGL01642:Gpd2 APN 2 57268071 nonsense probably null
IGL01816:Gpd2 APN 2 57364066 nonsense probably null
IGL02257:Gpd2 APN 2 57364524 missense probably benign 0.01
IGL02824:Gpd2 APN 2 57364327 missense probably null 0.89
IGL02832:Gpd2 APN 2 57338979 missense probably damaging 1.00
IGL03040:Gpd2 APN 2 57355793 missense probably benign 0.06
IGL03107:Gpd2 APN 2 57355569 missense probably damaging 1.00
IGL03131:Gpd2 APN 2 57338843 splice site probably benign
IGL03218:Gpd2 APN 2 57307054 missense probably damaging 1.00
IGL03226:Gpd2 APN 2 57304486 critical splice donor site probably null
IGL03372:Gpd2 APN 2 57355507 missense probably damaging 1.00
kraft UTSW 2 57304396 missense probably damaging 0.96
R0012:Gpd2 UTSW 2 57338868 missense probably damaging 1.00
R0285:Gpd2 UTSW 2 57338955 missense probably benign 0.16
R0379:Gpd2 UTSW 2 57345263 missense probably damaging 1.00
R0401:Gpd2 UTSW 2 57340093 missense possibly damaging 0.94
R1347:Gpd2 UTSW 2 57357671 missense probably damaging 0.99
R1347:Gpd2 UTSW 2 57357671 missense probably damaging 0.99
R1468:Gpd2 UTSW 2 57355774 missense probably damaging 1.00
R1468:Gpd2 UTSW 2 57355774 missense probably damaging 1.00
R1490:Gpd2 UTSW 2 57355475 missense probably damaging 1.00
R1672:Gpd2 UTSW 2 57357700 missense probably damaging 0.97
R1709:Gpd2 UTSW 2 57357655 missense probably damaging 1.00
R1735:Gpd2 UTSW 2 57355551 missense probably damaging 1.00
R2056:Gpd2 UTSW 2 57339013 critical splice donor site probably null
R2959:Gpd2 UTSW 2 57338975 nonsense probably null
R2960:Gpd2 UTSW 2 57338975 nonsense probably null
R2961:Gpd2 UTSW 2 57338975 nonsense probably null
R3008:Gpd2 UTSW 2 57338975 nonsense probably null
R3009:Gpd2 UTSW 2 57338975 nonsense probably null
R3881:Gpd2 UTSW 2 57338975 nonsense probably null
R4073:Gpd2 UTSW 2 57290013 missense probably damaging 1.00
R4153:Gpd2 UTSW 2 57355771 missense probably damaging 1.00
R4564:Gpd2 UTSW 2 57307083 missense possibly damaging 0.77
R4952:Gpd2 UTSW 2 57307013 nonsense probably null
R5030:Gpd2 UTSW 2 57304405 missense probably damaging 0.98
R5101:Gpd2 UTSW 2 57355901 missense probably damaging 1.00
R5185:Gpd2 UTSW 2 57340204 missense probably damaging 1.00
R6020:Gpd2 UTSW 2 57364513 missense probably benign 0.18
R6325:Gpd2 UTSW 2 57304396 missense probably damaging 0.96
R6536:Gpd2 UTSW 2 57345355 missense probably benign 0.40
R6923:Gpd2 UTSW 2 57355788 missense probably damaging 0.98
R7058:Gpd2 UTSW 2 57307100 splice site probably null
R7380:Gpd2 UTSW 2 57340159 missense probably damaging 1.00
R8052:Gpd2 UTSW 2 57306950 nonsense probably null
R8098:Gpd2 UTSW 2 57290008 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GTGACACACTTCTGTACCACCC -3'
(R):5'- TTTCATGTTAAGCCAGGCATTG -3'

Sequencing Primer
(F):5'- TGTACCACCCGTCCGTG -3'
(R):5'- CATGTTAAGCCAGGCATTGTTGAC -3'
Posted On2014-12-29