Incidental Mutation 'R2962:Olfr539'
ID 255924
Institutional Source Beutler Lab
Gene Symbol Olfr539
Ensembl Gene ENSMUSG00000059136
Gene Name olfactory receptor 539
Synonyms MOR253-4, GA_x6K02T2PBJ9-42813436-42814368
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock # R2962 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 140659930-140678580 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 140667949 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 214 (M214L)
Ref Sequence ENSEMBL: ENSMUSP00000151522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078967] [ENSMUST00000210973] [ENSMUST00000218865]
AlphaFold Q8VGL9
Predicted Effect probably benign
Transcript: ENSMUST00000078967
AA Change: M221L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077990
Gene: ENSMUSG00000059136
AA Change: M221L

DomainStartEndE-ValueType
Pfam:7tm_4 40 316 6.5e-50 PFAM
Pfam:7tm_1 50 299 4.9e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210973
AA Change: M214L
Predicted Effect probably benign
Transcript: ENSMUST00000218865
AA Change: M214L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219853
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cd24a A G 10: 43,579,317 T22A probably benign Het
Cdk5rap2 ATGTG ATG 4: 70,289,977 probably null Het
Cog3 A G 14: 75,740,534 probably null Het
Gm3371 A T 14: 44,408,698 N103K probably benign Het
Gpd2 C T 2: 57,338,975 R264* probably null Het
Hoxc10 A G 15: 102,967,300 Y148C probably damaging Het
Jade1 C G 3: 41,613,327 T610S probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Malt1 A G 18: 65,448,335 H278R probably benign Het
Mlxip C A 5: 123,440,824 R178S probably damaging Het
Pdxk A G 10: 78,443,833 L236P probably damaging Het
Plekhg3 G A 12: 76,572,659 probably null Het
Rufy2 G T 10: 63,000,260 V323F probably damaging Het
Serpinb7 A G 1: 107,451,726 T288A probably benign Het
Tet1 A T 10: 62,814,544 C1628* probably null Het
Tgtp2 A G 11: 49,059,536 S70P probably damaging Het
Tmem211 T C 5: 113,238,056 V123A possibly damaging Het
Trank1 C T 9: 111,352,080 T390I probably damaging Het
Trim31 T C 17: 36,899,904 S143P probably damaging Het
Ube3c C A 5: 29,658,418 A897D possibly damaging Het
Unc79 A T 12: 103,095,119 T1050S possibly damaging Het
Zfr G A 15: 12,162,233 R823H probably benign Het
Other mutations in Olfr539
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Olfr539 APN 7 140667941 missense probably benign 0.01
IGL01610:Olfr539 APN 7 140667671 missense probably damaging 1.00
IGL02959:Olfr539 APN 7 140667550 missense probably damaging 1.00
IGL03406:Olfr539 APN 7 140667511 missense probably damaging 1.00
R0671:Olfr539 UTSW 7 140667677 missense probably damaging 1.00
R1771:Olfr539 UTSW 7 140668135 missense probably benign
R1934:Olfr539 UTSW 7 140668038 nonsense probably null
R1985:Olfr539 UTSW 7 140667821 missense probably damaging 1.00
R4239:Olfr539 UTSW 7 140667583 missense probably benign 0.07
R4240:Olfr539 UTSW 7 140667583 missense probably benign 0.07
R4360:Olfr539 UTSW 7 140667817 missense probably damaging 0.98
R4841:Olfr539 UTSW 7 140667589 missense probably damaging 1.00
R4842:Olfr539 UTSW 7 140667589 missense probably damaging 1.00
R4851:Olfr539 UTSW 7 140667313 missense probably benign
R5325:Olfr539 UTSW 7 140667792 missense probably benign 0.33
R5766:Olfr539 UTSW 7 140667353 missense probably benign 0.02
R6363:Olfr539 UTSW 7 140668082 missense possibly damaging 0.93
R6836:Olfr539 UTSW 7 140668180 missense possibly damaging 0.86
R7777:Olfr539 UTSW 7 140667941 missense probably benign 0.01
R7920:Olfr539 UTSW 7 140667901 missense possibly damaging 0.92
R8134:Olfr539 UTSW 7 140667767 missense possibly damaging 0.90
R8712:Olfr539 UTSW 7 140668139 missense possibly damaging 0.89
R9095:Olfr539 UTSW 7 140667900 missense probably damaging 1.00
R9158:Olfr539 UTSW 7 140667634 missense possibly damaging 0.76
R9603:Olfr539 UTSW 7 140667881 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATGTGTCCACACTGGTC -3'
(R):5'- GCAAGCTTGACATCCTTGTTC -3'

Sequencing Primer
(F):5'- ACACTGGTCTAATGACACGCTTG -3'
(R):5'- TGAGTACAGAACTGAGGTAACTTTGC -3'
Posted On 2014-12-29