Incidental Mutation 'R2962:Tgtp2'
ID 255931
Institutional Source Beutler Lab
Gene Symbol Tgtp2
Ensembl Gene ENSMUSG00000078921
Gene Name T cell specific GTPase 2
Synonyms
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2962 (G1)
Quality Score 172
Status Not validated
Chromosome 11
Chromosomal Location 48948021-48955033 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 48950363 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 70 (S70P)
Ref Sequence ENSEMBL: ENSMUSP00000045025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046745] [ENSMUST00000056759] [ENSMUST00000102785] [ENSMUST00000179282]
AlphaFold Q3T9E4
Q62293
Predicted Effect probably damaging
Transcript: ENSMUST00000046745
AA Change: S70P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045025
Gene: ENSMUSG00000078921
AA Change: S70P

DomainStartEndE-ValueType
Pfam:IIGP 22 395 2.9e-178 PFAM
Pfam:MMR_HSR1 58 217 5.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056759
SMART Domains Protein: ENSMUSP00000058544
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 1.5e-33 PFAM
Pfam:7tm_4 108 252 1.7e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102785
SMART Domains Protein: ENSMUSP00000099846
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 1.5e-33 PFAM
Pfam:7tm_4 108 252 1.7e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128411
Predicted Effect probably benign
Transcript: ENSMUST00000179282
SMART Domains Protein: ENSMUSP00000136647
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7tm_4 1 276 3.6e-51 PFAM
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 3.8e-26 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cd24a A G 10: 43,455,313 (GRCm39) T22A probably benign Het
Cdk5rap2 ATGTG ATG 4: 70,208,214 (GRCm39) probably null Het
Cog3 A G 14: 75,977,974 (GRCm39) probably null Het
Gm3371 A T 14: 44,646,155 (GRCm39) N103K probably benign Het
Gpd2 C T 2: 57,228,987 (GRCm39) R264* probably null Het
Hoxc10 A G 15: 102,875,735 (GRCm39) Y148C probably damaging Het
Jade1 C G 3: 41,567,762 (GRCm39) T610S probably benign Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Lhfpl7 T C 5: 113,385,922 (GRCm39) V123A possibly damaging Het
Malt1 A G 18: 65,581,406 (GRCm39) H278R probably benign Het
Mlxip C A 5: 123,578,887 (GRCm39) R178S probably damaging Het
Or13a25 A T 7: 140,247,862 (GRCm39) M214L probably benign Het
Pdxk A G 10: 78,279,667 (GRCm39) L236P probably damaging Het
Plekhg3 G A 12: 76,619,433 (GRCm39) probably null Het
Rufy2 G T 10: 62,836,039 (GRCm39) V323F probably damaging Het
Serpinb7 A G 1: 107,379,456 (GRCm39) T288A probably benign Het
Tet1 A T 10: 62,650,323 (GRCm39) C1628* probably null Het
Trank1 C T 9: 111,181,148 (GRCm39) T390I probably damaging Het
Trim31 T C 17: 37,210,796 (GRCm39) S143P probably damaging Het
Ube3c C A 5: 29,863,416 (GRCm39) A897D possibly damaging Het
Unc79 A T 12: 103,061,378 (GRCm39) T1050S possibly damaging Het
Zfr G A 15: 12,162,319 (GRCm39) R823H probably benign Het
Other mutations in Tgtp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02450:Tgtp2 APN 11 48,950,317 (GRCm39) missense probably benign 0.35
Aha2016 UTSW 11 48,950,179 (GRCm39) missense probably damaging 1.00
R1498:Tgtp2 UTSW 11 48,950,165 (GRCm39) missense probably damaging 1.00
R1779:Tgtp2 UTSW 11 48,949,751 (GRCm39) missense probably benign
R1958:Tgtp2 UTSW 11 48,949,919 (GRCm39) missense probably damaging 1.00
R2402:Tgtp2 UTSW 11 48,949,957 (GRCm39) missense probably benign 0.00
R4124:Tgtp2 UTSW 11 48,950,238 (GRCm39) missense probably damaging 0.99
R4484:Tgtp2 UTSW 11 48,950,179 (GRCm39) missense probably damaging 1.00
R4602:Tgtp2 UTSW 11 48,949,811 (GRCm39) missense probably damaging 1.00
R4772:Tgtp2 UTSW 11 48,949,811 (GRCm39) missense probably damaging 1.00
R4965:Tgtp2 UTSW 11 48,950,237 (GRCm39) missense probably damaging 1.00
R5263:Tgtp2 UTSW 11 48,950,090 (GRCm39) missense probably damaging 1.00
R5426:Tgtp2 UTSW 11 48,950,083 (GRCm39) missense probably benign
R7128:Tgtp2 UTSW 11 48,950,135 (GRCm39) missense possibly damaging 0.77
R7147:Tgtp2 UTSW 11 48,950,135 (GRCm39) missense probably damaging 1.00
R7188:Tgtp2 UTSW 11 48,950,135 (GRCm39) missense probably damaging 1.00
R8334:Tgtp2 UTSW 11 48,949,721 (GRCm39) missense probably benign 0.05
R9306:Tgtp2 UTSW 11 48,949,865 (GRCm39) missense probably benign 0.00
R9395:Tgtp2 UTSW 11 48,950,083 (GRCm39) missense probably benign
Z1177:Tgtp2 UTSW 11 48,950,178 (GRCm39) missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- ACTCACCAAACTTCATTTCTGTCAG -3'
(R):5'- TTGGGCCTCCAGCTTTGATG -3'

Sequencing Primer
(F):5'- CTTCATTTCTGTCAGATAGTTTTGTG -3'
(R):5'- TCCAGCTTTGATGCATTCTTTAAG -3'
Posted On 2014-12-29