Incidental Mutation 'R0322:Smg7'
List |< first << previous [record 43 of 56] next >> last >|
ID25594
Institutional Source Beutler Lab
Gene Symbol Smg7
Ensembl Gene ENSMUSG00000042772
Gene NameSmg-7 homolog, nonsense mediated mRNA decay factor (C. elegans)
Synonyms9430023P16Rik
MMRRC Submission 038532-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.927) question?
Stock #R0322 (G1)
Quality Score224
Status Validated
Chromosome1
Chromosomal Location152836995-152902646 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 152849873 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043560] [ENSMUST00000073441] [ENSMUST00000111836]
Predicted Effect probably null
Transcript: ENSMUST00000043560
SMART Domains Protein: ENSMUSP00000041241
Gene: ENSMUSG00000042772

DomainStartEndE-ValueType
Pfam:EST1 63 177 3.4e-30 PFAM
Pfam:EST1_DNA_bind 179 438 3.3e-64 PFAM
low complexity region 457 465 N/A INTRINSIC
low complexity region 615 633 N/A INTRINSIC
low complexity region 682 710 N/A INTRINSIC
low complexity region 711 729 N/A INTRINSIC
low complexity region 874 898 N/A INTRINSIC
low complexity region 906 922 N/A INTRINSIC
low complexity region 931 947 N/A INTRINSIC
low complexity region 1008 1034 N/A INTRINSIC
low complexity region 1126 1140 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000073441
SMART Domains Protein: ENSMUSP00000073144
Gene: ENSMUSG00000042772

DomainStartEndE-ValueType
Pfam:EST1 52 172 2.3e-26 PFAM
Pfam:EST1_DNA_bind 171 430 3.6e-66 PFAM
low complexity region 449 457 N/A INTRINSIC
low complexity region 653 671 N/A INTRINSIC
low complexity region 720 748 N/A INTRINSIC
low complexity region 749 767 N/A INTRINSIC
low complexity region 919 935 N/A INTRINSIC
low complexity region 996 1022 N/A INTRINSIC
low complexity region 1114 1128 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111836
SMART Domains Protein: ENSMUSP00000107467
Gene: ENSMUSG00000042772

DomainStartEndE-ValueType
Pfam:EST1 52 172 2.3e-26 PFAM
Pfam:EST1_DNA_bind 171 430 3.7e-66 PFAM
low complexity region 449 457 N/A INTRINSIC
low complexity region 607 625 N/A INTRINSIC
low complexity region 674 702 N/A INTRINSIC
low complexity region 703 721 N/A INTRINSIC
low complexity region 866 890 N/A INTRINSIC
low complexity region 898 914 N/A INTRINSIC
low complexity region 923 939 N/A INTRINSIC
low complexity region 1000 1026 N/A INTRINSIC
low complexity region 1118 1132 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186692
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188937
Meta Mutation Damage Score 0.9496 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.8%
  • 20x: 84.3%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is essential for nonsense-mediated mRNA decay (NMD); a process whereby transcripts with premature termination codons are targeted for rapid degradation by a mRNA decay complex. The mRNA decay complex consists, in part, of this protein along with proteins SMG5 and UPF1. The N-terminal domain of this protein is thought to mediate its association with SMG5 or UPF1 while the C-terminal domain interacts with the mRNA decay complex. This protein may therefore couple changes in UPF1 phosphorylation state to the degradation of NMD-candidate transcripts. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,025,372 S275T possibly damaging Het
Adam34 G T 8: 43,651,921 T229N probably benign Het
Adgrb3 C A 1: 25,221,748 probably benign Het
Ankhd1 T A 18: 36,658,008 Y2478* probably null Het
Arl9 A G 5: 77,007,190 probably benign Het
Bub1b G A 2: 118,639,618 probably benign Het
Chl1 A T 6: 103,701,883 probably benign Het
Cobl T A 11: 12,267,072 E465V probably damaging Het
Cobll1 A T 2: 65,102,098 M520K possibly damaging Het
Dll3 A G 7: 28,296,368 V336A possibly damaging Het
Dnmbp T C 19: 43,854,846 H1193R probably damaging Het
Fbxo43 T C 15: 36,152,192 probably benign Het
Gart G A 16: 91,623,037 probably benign Het
Gjc3 A T 5: 137,957,498 M175K possibly damaging Het
Gm9008 T C 6: 76,496,418 Y405C probably benign Het
Gpc5 T A 14: 115,399,151 N415K probably benign Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Il7r A T 15: 9,510,215 F251I probably benign Het
Insc A G 7: 114,792,265 E141G probably damaging Het
Itm2c C T 1: 85,907,030 T160M probably damaging Het
Mboat1 T C 13: 30,232,080 probably benign Het
Mdm2 G T 10: 117,702,204 H96Q possibly damaging Het
Mettl13 A G 1: 162,544,176 probably benign Het
Mfsd4b3 T C 10: 39,947,530 N245D probably damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mtmr3 T C 11: 4,487,505 Y982C possibly damaging Het
Mymk A T 2: 27,067,406 L66Q probably damaging Het
Myo18a T C 11: 77,829,800 S767P probably damaging Het
Ndufa8 T C 2: 36,036,622 D134G probably benign Het
Noxa1 A G 2: 25,092,554 F83S probably damaging Het
Npc1l1 T A 11: 6,229,042 I123L probably benign Het
Ogdhl A G 14: 32,337,577 T394A probably benign Het
Olfr1193 T C 2: 88,678,667 S264P probably damaging Het
Olfr290 A G 7: 84,916,313 Y178C probably damaging Het
Pcdh20 T C 14: 88,468,947 T306A probably benign Het
Pcid2 G A 8: 13,090,775 probably benign Het
Phyhip G A 14: 70,463,396 V108M possibly damaging Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Psmb4 A G 3: 94,886,091 Y160H probably benign Het
Riox2 A T 16: 59,489,389 K369* probably null Het
Sh3tc1 G A 5: 35,706,561 P761S possibly damaging Het
Slc6a3 T A 13: 73,560,926 V323D possibly damaging Het
Srrt G A 5: 137,296,608 R370C probably damaging Het
Stc1 T C 14: 69,029,409 V7A probably benign Het
Svep1 G T 4: 58,057,996 probably benign Het
Tbpl2 A G 2: 24,094,979 V51A probably benign Het
Tecr A G 8: 83,572,243 Y248H probably damaging Het
Tenm3 A G 8: 48,236,912 probably benign Het
Tia1 C T 6: 86,420,387 A114V probably damaging Het
Tmprss11f A T 5: 86,591,416 M2K probably benign Het
Tnfsf8 T C 4: 63,834,166 T221A probably damaging Het
Tubgcp5 G A 7: 55,814,978 G536S probably damaging Het
Tyr A T 7: 87,492,917 I145N probably benign Het
Ubr4 T A 4: 139,422,418 V1809E probably damaging Het
Vmn2r65 A T 7: 84,946,548 N309K probably benign Het
Other mutations in Smg7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01751:Smg7 APN 1 152844061 missense possibly damaging 0.68
IGL02320:Smg7 APN 1 152868337 missense possibly damaging 0.49
IGL02336:Smg7 APN 1 152843279 missense probably benign
IGL02680:Smg7 APN 1 152845394 missense probably benign 0.15
IGL03232:Smg7 APN 1 152840156 missense probably damaging 1.00
chill UTSW 1 152840136 unclassified probably null
R0540:Smg7 UTSW 1 152855962 missense probably benign 0.00
R0685:Smg7 UTSW 1 152866648 missense probably damaging 1.00
R0707:Smg7 UTSW 1 152870757 splice site probably null
R1109:Smg7 UTSW 1 152845583 missense probably damaging 1.00
R1118:Smg7 UTSW 1 152866575 splice site probably benign
R1119:Smg7 UTSW 1 152866575 splice site probably benign
R1458:Smg7 UTSW 1 152855843 splice site probably null
R1759:Smg7 UTSW 1 152848846 missense probably benign 0.20
R1846:Smg7 UTSW 1 152848850 missense probably damaging 1.00
R2015:Smg7 UTSW 1 152860508 missense probably damaging 1.00
R2155:Smg7 UTSW 1 152840313 missense possibly damaging 0.49
R2199:Smg7 UTSW 1 152854328 missense probably damaging 1.00
R2234:Smg7 UTSW 1 152868313 missense probably damaging 1.00
R2235:Smg7 UTSW 1 152868313 missense probably damaging 1.00
R3861:Smg7 UTSW 1 152852598 missense probably null 1.00
R4597:Smg7 UTSW 1 152840301 critical splice donor site probably null
R4672:Smg7 UTSW 1 152845413 missense probably damaging 1.00
R4851:Smg7 UTSW 1 152844269 missense probably benign 0.00
R5486:Smg7 UTSW 1 152846176 missense probably damaging 0.97
R5607:Smg7 UTSW 1 152843234 missense probably damaging 0.98
R6131:Smg7 UTSW 1 152845211 critical splice donor site probably null
R6396:Smg7 UTSW 1 152848600 missense probably benign 0.33
R6401:Smg7 UTSW 1 152840136 unclassified probably null
R6905:Smg7 UTSW 1 152850006 splice site probably null
R6961:Smg7 UTSW 1 152841583 nonsense probably null
R7051:Smg7 UTSW 1 152848850 missense probably damaging 1.00
R7124:Smg7 UTSW 1 152878080 missense probably benign 0.01
R7146:Smg7 UTSW 1 152861825 missense probably benign 0.34
R7573:Smg7 UTSW 1 152859489 missense probably damaging 1.00
R7578:Smg7 UTSW 1 152845430 missense probably damaging 1.00
R7621:Smg7 UTSW 1 152841544 missense possibly damaging 0.95
R8167:Smg7 UTSW 1 152844372 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TCCTGAGCGAAAATAACTGGCACATC -3'
(R):5'- CCTGGCATTGACAAAGACATGGATTCC -3'

Sequencing Primer
(F):5'- TGCTTACAAACCGGAGCAG -3'
(R):5'- GACAAAGACATGGATTCCATCTTAG -3'
Posted On2013-04-16