Incidental Mutation 'R2963:Cyp2t4'
ID255943
Institutional Source Beutler Lab
Gene Symbol Cyp2t4
Ensembl Gene ENSMUSG00000078787
Gene Namecytochrome P450, family 2, subfamily t, polypeptide 4
SynonymsLOC384724
Accession Numbers

Genbank: NM_001100184; MGI: 2686296

Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R2963 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location27153714-27158668 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27155274 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 60 (S60P)
Ref Sequence ENSEMBL: ENSMUSP00000126779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080058] [ENSMUST00000108382] [ENSMUST00000108385] [ENSMUST00000164093]
Predicted Effect probably benign
Transcript: ENSMUST00000080058
SMART Domains Protein: ENSMUSP00000078966
Gene: ENSMUSG00000058709

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 64 73 N/A INTRINSIC
Blast:P4Hc 75 136 3e-14 BLAST
low complexity region 154 174 N/A INTRINSIC
P4Hc 201 387 9.71e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108382
SMART Domains Protein: ENSMUSP00000104019
Gene: ENSMUSG00000058709

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 64 73 N/A INTRINSIC
Blast:P4Hc 75 136 3e-14 BLAST
low complexity region 154 174 N/A INTRINSIC
P4Hc 201 387 9.71e-44 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108385
AA Change: S52P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104022
Gene: ENSMUSG00000078787
AA Change: S52P

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 35 492 5.3e-130 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152021
Predicted Effect possibly damaging
Transcript: ENSMUST00000164093
AA Change: S60P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126779
Gene: ENSMUSG00000078787
AA Change: S60P

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:p450 43 500 2.6e-130 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 10 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alcam T C 16: 52,295,041 E238G probably benign Het
Angptl4 G A 17: 33,777,034 P323S possibly damaging Het
Capn13 C T 17: 73,315,263 probably null Het
Cdk5rap2 ATGTG ATG 4: 70,289,977 probably null Het
Cyfip1 T C 7: 55,895,035 F472L probably damaging Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Olfr1318 T A 2: 112,156,459 C169* probably null Het
Ptpn18 C T 1: 34,471,692 Q246* probably null Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Zfr G A 15: 12,162,233 R823H probably benign Het
Other mutations in Cyp2t4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Cyp2t4 APN 7 27155298 missense probably benign 0.00
IGL00706:Cyp2t4 APN 7 27155158 missense probably benign 0.01
IGL02926:Cyp2t4 APN 7 27157803 missense probably damaging 1.00
R0560:Cyp2t4 UTSW 7 27158511 missense probably damaging 0.99
R0632:Cyp2t4 UTSW 7 27158246 missense possibly damaging 0.82
R0788:Cyp2t4 UTSW 7 27155163 missense probably null
R1353:Cyp2t4 UTSW 7 27156630 missense probably benign 0.03
R1652:Cyp2t4 UTSW 7 27157390 missense possibly damaging 0.48
R1838:Cyp2t4 UTSW 7 27158416 missense possibly damaging 0.92
R1997:Cyp2t4 UTSW 7 27157613 critical splice donor site probably null
R2136:Cyp2t4 UTSW 7 27158160 missense probably benign 0.32
R6239:Cyp2t4 UTSW 7 27157475 missense possibly damaging 0.73
R6634:Cyp2t4 UTSW 7 27155788 nonsense probably null
R7251:Cyp2t4 UTSW 7 27157719 missense possibly damaging 0.72
R7348:Cyp2t4 UTSW 7 27157251 missense probably benign 0.01
R7436:Cyp2t4 UTSW 7 27158243 missense probably damaging 0.99
R8350:Cyp2t4 UTSW 7 27157381 missense possibly damaging 0.51
R8352:Cyp2t4 UTSW 7 27157737 missense probably benign 0.04
Z1088:Cyp2t4 UTSW 7 27157746 missense probably damaging 1.00
Z1177:Cyp2t4 UTSW 7 27158240 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCGCACATTGAGGATCTTAGAC -3'
(R):5'- AGCTCTTAGACACAGGGGTC -3'

Sequencing Primer
(F):5'- ATCTTAGACAGGATGGTCACCTGC -3'
(R):5'- TTAGACACAGGGGTCCAGGC -3'
Posted On2014-12-29