Incidental Mutation 'R0322:Mettl13'
ID25595
Institutional Source Beutler Lab
Gene Symbol Mettl13
Ensembl Gene ENSMUSG00000026694
Gene Namemethyltransferase like 13
Synonyms5630401D24Rik
MMRRC Submission 038532-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R0322 (G1)
Quality Score207
Status Validated
Chromosome1
Chromosomal Location162532127-162548551 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 162544176 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028017] [ENSMUST00000159316] [ENSMUST00000159817] [ENSMUST00000176220]
Predicted Effect probably benign
Transcript: ENSMUST00000028017
SMART Domains Protein: ENSMUSP00000028017
Gene: ENSMUSG00000026694

DomainStartEndE-ValueType
Pfam:TPMT 13 172 1e-7 PFAM
Pfam:Ubie_methyltran 38 190 6.6e-7 PFAM
Pfam:Methyltransf_31 46 198 5.3e-13 PFAM
Pfam:Methyltransf_18 48 161 1.1e-10 PFAM
Pfam:Methyltransf_25 52 154 3.7e-9 PFAM
Pfam:Methyltransf_11 53 158 4.1e-16 PFAM
low complexity region 436 452 N/A INTRINSIC
Pfam:Spermine_synth 472 630 7.4e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159255
Predicted Effect probably benign
Transcript: ENSMUST00000159316
SMART Domains Protein: ENSMUSP00000135822
Gene: ENSMUSG00000026694

DomainStartEndE-ValueType
Pfam:Methyltransf_25 1 101 2.7e-10 PFAM
Pfam:Methyltransf_18 1 102 8e-11 PFAM
Pfam:Methyltransf_31 1 149 1.9e-12 PFAM
Pfam:Methyltransf_11 2 100 1.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159817
SMART Domains Protein: ENSMUSP00000124267
Gene: ENSMUSG00000026694

DomainStartEndE-ValueType
Pfam:TPMT 13 144 4.6e-8 PFAM
Pfam:Methyltransf_31 46 195 3.5e-12 PFAM
Pfam:Methyltransf_18 48 160 5e-11 PFAM
Pfam:Methyltransf_25 52 154 1.1e-9 PFAM
Pfam:Methyltransf_11 53 158 6e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161760
Predicted Effect probably benign
Transcript: ENSMUST00000176220
SMART Domains Protein: ENSMUSP00000135879
Gene: ENSMUSG00000026694

DomainStartEndE-ValueType
Pfam:Spermine_synth 73 239 1.8e-8 PFAM
Pfam:Methyltransf_18 126 234 1.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195027
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.8%
  • 20x: 84.3%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,025,372 S275T possibly damaging Het
Adam34 G T 8: 43,651,921 T229N probably benign Het
Adgrb3 C A 1: 25,221,748 probably benign Het
Ankhd1 T A 18: 36,658,008 Y2478* probably null Het
Arl9 A G 5: 77,007,190 probably benign Het
Bub1b G A 2: 118,639,618 probably benign Het
Chl1 A T 6: 103,701,883 probably benign Het
Cobl T A 11: 12,267,072 E465V probably damaging Het
Cobll1 A T 2: 65,102,098 M520K possibly damaging Het
Dll3 A G 7: 28,296,368 V336A possibly damaging Het
Dnmbp T C 19: 43,854,846 H1193R probably damaging Het
Fbxo43 T C 15: 36,152,192 probably benign Het
Gart G A 16: 91,623,037 probably benign Het
Gjc3 A T 5: 137,957,498 M175K possibly damaging Het
Gm9008 T C 6: 76,496,418 Y405C probably benign Het
Gpc5 T A 14: 115,399,151 N415K probably benign Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Il7r A T 15: 9,510,215 F251I probably benign Het
Insc A G 7: 114,792,265 E141G probably damaging Het
Itm2c C T 1: 85,907,030 T160M probably damaging Het
Mboat1 T C 13: 30,232,080 probably benign Het
Mdm2 G T 10: 117,702,204 H96Q possibly damaging Het
Mfsd4b3 T C 10: 39,947,530 N245D probably damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Mtmr3 T C 11: 4,487,505 Y982C possibly damaging Het
Mymk A T 2: 27,067,406 L66Q probably damaging Het
Myo18a T C 11: 77,829,800 S767P probably damaging Het
Ndufa8 T C 2: 36,036,622 D134G probably benign Het
Noxa1 A G 2: 25,092,554 F83S probably damaging Het
Npc1l1 T A 11: 6,229,042 I123L probably benign Het
Ogdhl A G 14: 32,337,577 T394A probably benign Het
Olfr1193 T C 2: 88,678,667 S264P probably damaging Het
Olfr290 A G 7: 84,916,313 Y178C probably damaging Het
Pcdh20 T C 14: 88,468,947 T306A probably benign Het
Pcid2 G A 8: 13,090,775 probably benign Het
Phyhip G A 14: 70,463,396 V108M possibly damaging Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Psmb4 A G 3: 94,886,091 Y160H probably benign Het
Riox2 A T 16: 59,489,389 K369* probably null Het
Sh3tc1 G A 5: 35,706,561 P761S possibly damaging Het
Slc6a3 T A 13: 73,560,926 V323D possibly damaging Het
Smg7 A G 1: 152,849,873 probably null Het
Srrt G A 5: 137,296,608 R370C probably damaging Het
Stc1 T C 14: 69,029,409 V7A probably benign Het
Svep1 G T 4: 58,057,996 probably benign Het
Tbpl2 A G 2: 24,094,979 V51A probably benign Het
Tecr A G 8: 83,572,243 Y248H probably damaging Het
Tenm3 A G 8: 48,236,912 probably benign Het
Tia1 C T 6: 86,420,387 A114V probably damaging Het
Tmprss11f A T 5: 86,591,416 M2K probably benign Het
Tnfsf8 T C 4: 63,834,166 T221A probably damaging Het
Tubgcp5 G A 7: 55,814,978 G536S probably damaging Het
Tyr A T 7: 87,492,917 I145N probably benign Het
Ubr4 T A 4: 139,422,418 V1809E probably damaging Het
Vmn2r65 A T 7: 84,946,548 N309K probably benign Het
Other mutations in Mettl13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Mettl13 APN 1 162535865 missense possibly damaging 0.74
IGL00589:Mettl13 APN 1 162542391 missense probably damaging 1.00
IGL01765:Mettl13 APN 1 162538953 missense probably benign
IGL02200:Mettl13 APN 1 162538823 intron probably benign
IGL02835:Mettl13 UTSW 1 162546016 missense probably damaging 0.97
R0055:Mettl13 UTSW 1 162546181 missense probably damaging 1.00
R0390:Mettl13 UTSW 1 162538889 missense possibly damaging 0.51
R0423:Mettl13 UTSW 1 162544385 missense probably damaging 1.00
R0723:Mettl13 UTSW 1 162534430 missense probably damaging 1.00
R1472:Mettl13 UTSW 1 162537167 missense possibly damaging 0.95
R2429:Mettl13 UTSW 1 162546325 nonsense probably null
R3755:Mettl13 UTSW 1 162544220 missense probably damaging 0.97
R3756:Mettl13 UTSW 1 162544220 missense probably damaging 0.97
R4058:Mettl13 UTSW 1 162546186 missense probably damaging 1.00
R4059:Mettl13 UTSW 1 162546186 missense probably damaging 1.00
R4087:Mettl13 UTSW 1 162548202 missense possibly damaging 0.53
R4885:Mettl13 UTSW 1 162537268 missense probably damaging 0.99
R4974:Mettl13 UTSW 1 162537220 missense probably damaging 0.99
R5070:Mettl13 UTSW 1 162545899 missense possibly damaging 0.47
R5447:Mettl13 UTSW 1 162535880 missense probably benign 0.01
R5702:Mettl13 UTSW 1 162545980 missense probably benign 0.00
R6137:Mettl13 UTSW 1 162535886 missense probably benign 0.09
R6570:Mettl13 UTSW 1 162544286 missense probably damaging 0.99
R6754:Mettl13 UTSW 1 162548123 missense probably damaging 1.00
R7340:Mettl13 UTSW 1 162538978 missense probably benign 0.00
R7386:Mettl13 UTSW 1 162548154 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCAACACCTTGAGTGGCTCATC -3'
(R):5'- GCCTTGAACATTTCACCAGCACTCC -3'

Sequencing Primer
(F):5'- gccatctcgccagcctc -3'
(R):5'- ACCGAGTGGCTCTTTGGC -3'
Posted On2013-04-16