Mutagenetix > Incidental Mutation

Incidental Mutation 'R2963:Tex11'

255950

Institutional Source

Beutler Lab

Gene Symbol

Tex11

Ensembl Gene

ENSMUSG00000009670

Gene Name

testis expressed gene 11

Synonyms

4930565P14Rik

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.237) question?

Stock #

R2963 (G1)

Quality Score

222

Status

Not validated

Chromosome

Chromosomal Location

99882254-100103245 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 99977021 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 487 (A487S)

Ref Sequence

ENSEMBL: ENSMUSP00000109347 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009814] [ENSMUST00000113716] [ENSMUST00000113718]

AlphaFold

Q14AT2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000009814
AA Change: A487S

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000009814
Gene: ENSMUSG00000009670
AA Change: A487S

Domain	Start	End	E-Value	Type
Pfam:SPO22	176	431	1.1e-62	PFAM
low complexity region	702	713	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113716
AA Change: A487S

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000109345
Gene: ENSMUSG00000009670
AA Change: A487S

Domain	Start	End	E-Value	Type
Pfam:SPO22	175	433	2.1e-70	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113718
AA Change: A487S

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000109347
Gene: ENSMUSG00000009670
AA Change: A487S

Domain	Start	End	E-Value	Type
Pfam:SPO22	175	433	3.8e-70	PFAM
low complexity region	702	713	N/A	INTRINSIC

Meta Mutation Damage Score

0.3188

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is X-linked and is expressed in only male germ cells. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Miche homozygous for a knockout allele exhibit abnormal male meiosis. Mice homozygous for a conditional knockout exhibit male infertility and reduced female fecundity due to abnormal meiosis following cre recombination. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 10 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alcam	T	C	16: 52,115,404 (GRCm39)	E238G	probably benign	Het
Angptl4	G	A	17: 33,996,008 (GRCm39)	P323S	possibly damaging	Het
Capn13	C	T	17: 73,622,258 (GRCm39)		probably null	Het
Cdk5rap2	ATGTG	ATG	4: 70,208,214 (GRCm39)		probably null	Het
Cyfip1	T	C	7: 55,544,783 (GRCm39)	F472L	probably damaging	Het
Cyp2t4	T	C	7: 26,854,699 (GRCm39)	S60P	possibly damaging	Het
Nfix	CAAAAA	CAAAA	8: 85,442,876 (GRCm39)		probably null	Het
Or4f62	T	A	2: 111,986,804 (GRCm39)	C169*	probably null	Het
Ptpn18	C	T	1: 34,510,773 (GRCm39)	Q246*	probably null	Het
Zfr	G	A	15: 12,162,319 (GRCm39)	R823H	probably benign	Het

Other mutations in Tex11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00536:Tex11	APN	X	100,076,165 (GRCm39)	missense	probably null	0.00
IGL00838:Tex11	APN	X	100,015,724 (GRCm39)	missense	possibly damaging	0.92
IGL02385:Tex11	APN	X	99,920,135 (GRCm39)	splice site	probably benign
R2958:Tex11	UTSW	X	99,977,021 (GRCm39)	missense	possibly damaging	0.70
R2960:Tex11	UTSW	X	99,977,021 (GRCm39)	missense	possibly damaging	0.70
R3008:Tex11	UTSW	X	99,977,021 (GRCm39)	missense	possibly damaging	0.70
R3009:Tex11	UTSW	X	99,977,021 (GRCm39)	missense	possibly damaging	0.70
R3010:Tex11	UTSW	X	99,977,021 (GRCm39)	missense	possibly damaging	0.70
R3011:Tex11	UTSW	X	99,977,021 (GRCm39)	missense	possibly damaging	0.70
R3745:Tex11	UTSW	X	99,960,178 (GRCm39)	missense	probably benign	0.33
R3881:Tex11	UTSW	X	99,977,021 (GRCm39)	missense	possibly damaging	0.70
R3882:Tex11	UTSW	X	99,977,021 (GRCm39)	missense	possibly damaging	0.70
R4081:Tex11	UTSW	X	99,977,021 (GRCm39)	missense	possibly damaging	0.70
R4082:Tex11	UTSW	X	99,977,021 (GRCm39)	missense	possibly damaging	0.70
R4159:Tex11	UTSW	X	99,977,021 (GRCm39)	missense	possibly damaging	0.70
R4172:Tex11	UTSW	X	99,977,021 (GRCm39)	missense	possibly damaging	0.70
R4197:Tex11	UTSW	X	99,977,021 (GRCm39)	missense	possibly damaging	0.70
R4201:Tex11	UTSW	X	99,977,021 (GRCm39)	missense	possibly damaging	0.70
R4204:Tex11	UTSW	X	99,977,021 (GRCm39)	missense	possibly damaging	0.70
R4206:Tex11	UTSW	X	99,977,021 (GRCm39)	missense	possibly damaging	0.70
R4304:Tex11	UTSW	X	99,977,021 (GRCm39)	missense	possibly damaging	0.70
R4305:Tex11	UTSW	X	99,977,021 (GRCm39)	missense	possibly damaging	0.70
R8726:Tex11	UTSW	X	100,059,191 (GRCm39)	missense	possibly damaging	0.82
R8727:Tex11	UTSW	X	100,059,191 (GRCm39)	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- ATGATGGTTTCCCGAATTCTTGTCC -3'
(R):5'- GAGTACTCCTCAACAATTGTGTC -3'

Sequencing Primer
(F):5'- CTTGTCCAATATTTGCCCATTTAAG -3'
(R):5'- GCCATAGCAGAAGTTGAG -3'

Posted On

2014-12-29