Incidental Mutation 'R2964:Dbi'
ID255953
Institutional Source Beutler Lab
Gene Symbol Dbi
Ensembl Gene ENSMUSG00000026385
Gene Namediazepam binding inhibitor
SynonymsAcbp, diazepam-binding inhibitor, EP, endozepine
MMRRC Submission 040520-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R2964 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location120113280-120121078 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 120120116 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027634] [ENSMUST00000027637] [ENSMUST00000056038] [ENSMUST00000112644] [ENSMUST00000112648] [ENSMUST00000132118] [ENSMUST00000151708]
Predicted Effect probably benign
Transcript: ENSMUST00000027634
SMART Domains Protein: ENSMUSP00000027634
Gene: ENSMUSG00000026385

DomainStartEndE-ValueType
Pfam:ACBP 3 83 1.2e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000027637
SMART Domains Protein: ENSMUSP00000027637
Gene: ENSMUSG00000026388

DomainStartEndE-ValueType
Pfam:DUF2340 8 93 3.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056038
SMART Domains Protein: ENSMUSP00000053335
Gene: ENSMUSG00000026388

DomainStartEndE-ValueType
Pfam:DUF2340 8 93 3.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112644
SMART Domains Protein: ENSMUSP00000108263
Gene: ENSMUSG00000026388

DomainStartEndE-ValueType
Pfam:DUF2340 8 126 1.4e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112648
SMART Domains Protein: ENSMUSP00000108267
Gene: ENSMUSG00000026385

DomainStartEndE-ValueType
Pfam:ACBP 1 62 2.6e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128408
Predicted Effect probably benign
Transcript: ENSMUST00000132118
SMART Domains Protein: ENSMUSP00000138014
Gene: ENSMUSG00000026385

DomainStartEndE-ValueType
Pfam:ACBP 2 70 7.9e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135937
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149628
Predicted Effect probably benign
Transcript: ENSMUST00000151708
SMART Domains Protein: ENSMUSP00000114705
Gene: ENSMUSG00000026385

DomainStartEndE-ValueType
Pfam:ACBP 50 134 1.3e-33 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes diazepam binding inhibitor, a protein that is regulated by hormones and is involved in lipid metabolism and the displacement of beta-carbolines and benzodiazepines, which modulate signal transduction at type A gamma-aminobutyric acid receptors located in brain synapses. The protein is conserved from yeast to mammals, with the most highly conserved domain consisting of seven contiguous residues that constitute the hydrophobic binding site for medium- and long-chain acyl-Coenzyme A esters. Diazepam binding inhibitor is also known to mediate the feedback regulation of pancreatic secretion and the postprandial release of cholecystokinin, in addition to its role as a mediator in corticotropin-dependent adrenal steroidogenesis. Three pseudogenes located on chromosomes 6, 8 and 16 have been identified. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal fur and skin morphology at P16 and impaired metabolic changes at weaning with reduced growth and hepatic cholesterol synthesis. Mice homozygous for a different knock-out allele complete exhibit embryonic lethality around implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,626,405 R511* probably null Het
Acox3 T C 5: 35,605,267 I495T possibly damaging Het
Acsl3 A G 1: 78,694,294 S302G probably benign Het
Ap1s1 T C 5: 137,037,503 D148G probably damaging Het
Asprv1 T A 6: 86,628,366 C65S probably damaging Het
Cdkal1 A G 13: 29,444,035 S39P unknown Het
Chrna2 T C 14: 66,149,368 V321A possibly damaging Het
Chsy1 G A 7: 66,172,164 G716R probably damaging Het
Col13a1 G A 10: 61,961,331 R106W probably damaging Het
Cul9 A G 17: 46,502,228 V2355A probably damaging Het
Cwh43 T C 5: 73,408,336 probably benign Het
Dync1h1 G A 12: 110,641,026 probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Fstl3 T C 10: 79,781,223 V200A probably benign Het
Gpr45 G A 1: 43,032,508 D104N possibly damaging Het
Gsdma2 T C 11: 98,657,259 S184P probably damaging Het
Gtf2ird1 T C 5: 134,357,684 probably null Het
H2-T22 A G 17: 36,040,645 L231S probably damaging Het
Hrh4 T C 18: 13,022,369 C322R probably benign Het
Ing1 T A 8: 11,561,641 S26R probably benign Het
Kif3a A T 11: 53,578,930 I123F probably damaging Het
Lrp6 T C 6: 134,467,526 E1127G probably damaging Het
Ltf G T 9: 111,028,472 C443F possibly damaging Het
Mdc1 A T 17: 35,853,637 Q1359L possibly damaging Het
Mdga1 A T 17: 29,852,468 I393N probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Myo3a T C 2: 22,340,256 V509A possibly damaging Het
Nav2 C T 7: 49,557,032 T1535I probably damaging Het
Nlrp4d G T 7: 10,378,329 S626* probably null Het
Nup188 T A 2: 30,325,346 I732K probably damaging Het
Olfr1453 C T 19: 13,028,048 A94T probably benign Het
Olfr340 T C 2: 36,452,767 F61L probably damaging Het
Olfr355 G A 2: 36,927,407 R236C probably benign Het
Oprm1 T C 10: 6,788,914 S14P probably damaging Het
Pigr G A 1: 130,841,535 V28M probably damaging Het
Pnpla2 C T 7: 141,458,478 L215F probably damaging Het
Pth T C 7: 113,385,929 H79R probably benign Het
Rasal1 T A 5: 120,671,620 L530Q probably damaging Het
Sdccag8 A T 1: 176,948,371 K616M possibly damaging Het
Slc4a5 C T 6: 83,296,669 T997I probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Trav7d-4 C T 14: 52,770,127 Q26* probably null Het
Zcchc8 A G 5: 123,720,867 S22P probably benign Het
Other mutations in Dbi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Dbi APN 1 120113477 missense probably benign 0.06
PIT4581001:Dbi UTSW 1 120119912 missense probably damaging 0.96
R4483:Dbi UTSW 1 120120805 missense probably benign 0.00
R5935:Dbi UTSW 1 120120853 missense probably benign 0.41
R7357:Dbi UTSW 1 120119893 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACCTGTATTTACATCGCCCACAG -3'
(R):5'- TCTCCGCTGATCATAGGTCG -3'

Sequencing Primer
(F):5'- CCCACAGTAGCTTGTTTGAAGTGAC -3'
(R):5'- ATCATAGGTCGGGCTTTACTGGAAC -3'
Posted On2014-12-29