Incidental Mutation 'R2964:Sdccag8'
ID255955
Institutional Source Beutler Lab
Gene Symbol Sdccag8
Ensembl Gene ENSMUSG00000026504
Gene Nameserologically defined colon cancer antigen 8
SynonymsCCCAP, 2700048G21Rik, 5730470G24Rik
MMRRC Submission 040520-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2964 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location176814660-177020437 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 176948371 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 616 (K616M)
Ref Sequence ENSEMBL: ENSMUSP00000027785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027785] [ENSMUST00000123409]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027785
AA Change: K616M

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027785
Gene: ENSMUSG00000026504
AA Change: K616M

DomainStartEndE-ValueType
Pfam:CCCAP 6 710 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123409
SMART Domains Protein: ENSMUSP00000137948
Gene: ENSMUSG00000026504

DomainStartEndE-ValueType
low complexity region 92 105 N/A INTRINSIC
coiled coil region 132 168 N/A INTRINSIC
coiled coil region 228 278 N/A INTRINSIC
coiled coil region 307 327 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133305
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosome associated protein. This protein may be involved in organizing the centrosome during interphase and mitosis. Mutations in this gene are associated with retinal-renal ciliopathy. [provided by RefSeq, Oct 2010]
PHENOTYPE: Homozygotes for a null allele show postnatal lethality, cleft palate, polydactyly, enlarged lateral ventricles and impaired neuronal migration. Homozygotes for a gene trap allele show late-onset nephronophthisis associated with renal cysts and fibrosis, and retinal degeneration leading to blindness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,626,405 R511* probably null Het
Acox3 T C 5: 35,605,267 I495T possibly damaging Het
Acsl3 A G 1: 78,694,294 S302G probably benign Het
Ap1s1 T C 5: 137,037,503 D148G probably damaging Het
Asprv1 T A 6: 86,628,366 C65S probably damaging Het
Cdkal1 A G 13: 29,444,035 S39P unknown Het
Chrna2 T C 14: 66,149,368 V321A possibly damaging Het
Chsy1 G A 7: 66,172,164 G716R probably damaging Het
Col13a1 G A 10: 61,961,331 R106W probably damaging Het
Cul9 A G 17: 46,502,228 V2355A probably damaging Het
Cwh43 T C 5: 73,408,336 probably benign Het
Dbi C T 1: 120,120,116 probably benign Het
Dync1h1 G A 12: 110,641,026 probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Fstl3 T C 10: 79,781,223 V200A probably benign Het
Gpr45 G A 1: 43,032,508 D104N possibly damaging Het
Gsdma2 T C 11: 98,657,259 S184P probably damaging Het
Gtf2ird1 T C 5: 134,357,684 probably null Het
H2-T22 A G 17: 36,040,645 L231S probably damaging Het
Hrh4 T C 18: 13,022,369 C322R probably benign Het
Ing1 T A 8: 11,561,641 S26R probably benign Het
Kif3a A T 11: 53,578,930 I123F probably damaging Het
Lrp6 T C 6: 134,467,526 E1127G probably damaging Het
Ltf G T 9: 111,028,472 C443F possibly damaging Het
Mdc1 A T 17: 35,853,637 Q1359L possibly damaging Het
Mdga1 A T 17: 29,852,468 I393N probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Myo3a T C 2: 22,340,256 V509A possibly damaging Het
Nav2 C T 7: 49,557,032 T1535I probably damaging Het
Nlrp4d G T 7: 10,378,329 S626* probably null Het
Nup188 T A 2: 30,325,346 I732K probably damaging Het
Olfr1453 C T 19: 13,028,048 A94T probably benign Het
Olfr340 T C 2: 36,452,767 F61L probably damaging Het
Olfr355 G A 2: 36,927,407 R236C probably benign Het
Oprm1 T C 10: 6,788,914 S14P probably damaging Het
Pigr G A 1: 130,841,535 V28M probably damaging Het
Pnpla2 C T 7: 141,458,478 L215F probably damaging Het
Pth T C 7: 113,385,929 H79R probably benign Het
Rasal1 T A 5: 120,671,620 L530Q probably damaging Het
Slc4a5 C T 6: 83,296,669 T997I probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Trav7d-4 C T 14: 52,770,127 Q26* probably null Het
Zcchc8 A G 5: 123,720,867 S22P probably benign Het
Other mutations in Sdccag8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Sdccag8 APN 1 176878002 missense possibly damaging 0.67
IGL01446:Sdccag8 APN 1 176845245 missense probably damaging 1.00
IGL01794:Sdccag8 APN 1 176845307 missense possibly damaging 0.69
IGL02179:Sdccag8 APN 1 176878056 missense probably benign 0.19
IGL02313:Sdccag8 APN 1 176824755 missense possibly damaging 0.48
IGL02962:Sdccag8 APN 1 176948362 missense probably damaging 1.00
R0433:Sdccag8 UTSW 1 176844821 splice site probably null
R0762:Sdccag8 UTSW 1 176946144 missense probably benign 0.05
R1928:Sdccag8 UTSW 1 176828970 missense probably damaging 1.00
R2132:Sdccag8 UTSW 1 176955889 missense probably damaging 1.00
R2342:Sdccag8 UTSW 1 176919641 missense probably benign 0.26
R3800:Sdccag8 UTSW 1 176868338 nonsense probably null
R3853:Sdccag8 UTSW 1 176853795 missense probably damaging 1.00
R4409:Sdccag8 UTSW 1 176868366 critical splice donor site probably null
R4590:Sdccag8 UTSW 1 176948292 missense probably damaging 1.00
R5036:Sdccag8 UTSW 1 177011975 missense probably damaging 0.99
R5083:Sdccag8 UTSW 1 176824892 missense probably damaging 1.00
R5174:Sdccag8 UTSW 1 176845350 missense probably damaging 0.99
R5739:Sdccag8 UTSW 1 176826231 missense probably benign 0.00
R5740:Sdccag8 UTSW 1 176831150 missense probably benign 0.02
R5898:Sdccag8 UTSW 1 176824822 missense probably benign 0.09
R6435:Sdccag8 UTSW 1 176814862 unclassified probably benign
R6624:Sdccag8 UTSW 1 176874812 intron probably null
R6763:Sdccag8 UTSW 1 176854627 intron probably null
R6877:Sdccag8 UTSW 1 177011935 missense probably damaging 1.00
R7130:Sdccag8 UTSW 1 176874601 missense probably damaging 0.97
R7331:Sdccag8 UTSW 1 176868290 missense possibly damaging 0.91
R7393:Sdccag8 UTSW 1 176840306 missense probably benign 0.00
X0024:Sdccag8 UTSW 1 176919629 missense probably damaging 1.00
Z1176:Sdccag8 UTSW 1 176868231 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGAAGCACGTTAGCACCG -3'
(R):5'- CCTCCTTGGGACAGAAAGGTTG -3'

Sequencing Primer
(F):5'- CACCGTGCATGGCAAGAGTTAC -3'
(R):5'- CTCCTTGGGACAGAAAGGTTGTCTAG -3'
Posted On2014-12-29