Incidental Mutation 'R2964:Fabp3'
ID255961
Institutional Source Beutler Lab
Gene Symbol Fabp3
Ensembl Gene ENSMUSG00000028773
Gene Namefatty acid binding protein 3, muscle and heart
SynonymsFabph4, Mdgi, H-FABP, Fabp3, Fabph1, Fabph-4, Fabph-1
MMRRC Submission 040520-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2964 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location130308595-130315463 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 130312387 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 57 (T57I)
Ref Sequence ENSEMBL: ENSMUSP00000070709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070532] [ENSMUST00000097865] [ENSMUST00000134159]
Predicted Effect probably benign
Transcript: ENSMUST00000070532
AA Change: T57I

PolyPhen 2 Score 0.208 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000070709
Gene: ENSMUSG00000028773
AA Change: T57I

DomainStartEndE-ValueType
Pfam:Lipocalin_7 3 133 3.2e-13 PFAM
Pfam:Lipocalin 6 132 4.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097865
SMART Domains Protein: ENSMUSP00000095477
Gene: ENSMUSG00000073752

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134159
SMART Domains Protein: ENSMUSP00000120807
Gene: ENSMUSG00000028772

DomainStartEndE-ValueType
S1 14 86 4.47e-11 SMART
ZnF_C2HC 132 148 4.56e-1 SMART
low complexity region 160 171 N/A INTRINSIC
low complexity region 182 211 N/A INTRINSIC
low complexity region 227 240 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149755
Meta Mutation Damage Score 0.7568 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The intracellular fatty acid-binding proteins (FABPs) belongs to a multigene family. FABPs are divided into at least three distinct types, namely the hepatic-, intestinal- and cardiac-type. They form 14-15 kDa proteins and are thought to participate in the uptake, intracellular metabolism and/or transport of long-chain fatty acids. They may also be responsible in the modulation of cell growth and proliferation. Fatty acid-binding protein 3 gene contains four exons and its function is to arrest growth of mammary epithelial cells. This gene is a candidate tumor suppressor gene for human breast cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Inactivation of this locus results in impaired fatty acid utilization. Homozygous null mice show exercise intolerance and cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,626,405 R511* probably null Het
Acox3 T C 5: 35,605,267 I495T possibly damaging Het
Acsl3 A G 1: 78,694,294 S302G probably benign Het
Ap1s1 T C 5: 137,037,503 D148G probably damaging Het
Asprv1 T A 6: 86,628,366 C65S probably damaging Het
Cdkal1 A G 13: 29,444,035 S39P unknown Het
Chrna2 T C 14: 66,149,368 V321A possibly damaging Het
Chsy1 G A 7: 66,172,164 G716R probably damaging Het
Col13a1 G A 10: 61,961,331 R106W probably damaging Het
Cul9 A G 17: 46,502,228 V2355A probably damaging Het
Cwh43 T C 5: 73,408,336 probably benign Het
Dbi C T 1: 120,120,116 probably benign Het
Dync1h1 G A 12: 110,641,026 probably null Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Fstl3 T C 10: 79,781,223 V200A probably benign Het
Gpr45 G A 1: 43,032,508 D104N possibly damaging Het
Gsdma2 T C 11: 98,657,259 S184P probably damaging Het
Gtf2ird1 T C 5: 134,357,684 probably null Het
H2-T22 A G 17: 36,040,645 L231S probably damaging Het
Hrh4 T C 18: 13,022,369 C322R probably benign Het
Ing1 T A 8: 11,561,641 S26R probably benign Het
Kif3a A T 11: 53,578,930 I123F probably damaging Het
Lrp6 T C 6: 134,467,526 E1127G probably damaging Het
Ltf G T 9: 111,028,472 C443F possibly damaging Het
Mdc1 A T 17: 35,853,637 Q1359L possibly damaging Het
Mdga1 A T 17: 29,852,468 I393N probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Myo3a T C 2: 22,340,256 V509A possibly damaging Het
Nav2 C T 7: 49,557,032 T1535I probably damaging Het
Nlrp4d G T 7: 10,378,329 S626* probably null Het
Nup188 T A 2: 30,325,346 I732K probably damaging Het
Olfr1453 C T 19: 13,028,048 A94T probably benign Het
Olfr340 T C 2: 36,452,767 F61L probably damaging Het
Olfr355 G A 2: 36,927,407 R236C probably benign Het
Oprm1 T C 10: 6,788,914 S14P probably damaging Het
Pigr G A 1: 130,841,535 V28M probably damaging Het
Pnpla2 C T 7: 141,458,478 L215F probably damaging Het
Pth T C 7: 113,385,929 H79R probably benign Het
Rasal1 T A 5: 120,671,620 L530Q probably damaging Het
Sdccag8 A T 1: 176,948,371 K616M possibly damaging Het
Slc4a5 C T 6: 83,296,669 T997I probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Trav7d-4 C T 14: 52,770,127 Q26* probably null Het
Zcchc8 A G 5: 123,720,867 S22P probably benign Het
Other mutations in Fabp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
cardio UTSW 4 130312387 missense probably benign 0.21
R1111:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1112:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1114:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1116:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1144:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1146:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1146:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1147:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1147:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1460:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1505:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1506:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1508:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1509:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1582:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1601:Fabp3 UTSW 4 130308848 missense probably benign 0.24
R1612:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1641:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1664:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1670:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1686:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1690:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1709:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1854:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1855:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R1935:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2107:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2208:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2211:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2392:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2393:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2829:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2830:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2831:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2901:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2975:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2979:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2980:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2981:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2982:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R2983:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R3430:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R3612:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R3613:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R3614:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R3755:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R3756:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R3825:Fabp3 UTSW 4 130312452 unclassified probably null
R3842:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4012:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4280:Fabp3 UTSW 4 130312452 unclassified probably null
R4282:Fabp3 UTSW 4 130312452 unclassified probably null
R4405:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4406:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4466:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4503:Fabp3 UTSW 4 130312452 unclassified probably null
R4547:Fabp3 UTSW 4 130312452 unclassified probably null
R4548:Fabp3 UTSW 4 130312452 unclassified probably null
R4671:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4681:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4710:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4743:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4850:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R4989:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R5015:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R5133:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R5134:Fabp3 UTSW 4 130312387 missense probably benign 0.21
R5549:Fabp3 UTSW 4 130315225 makesense probably null
R5884:Fabp3 UTSW 4 130312338 missense probably benign 0.01
R7170:Fabp3 UTSW 4 130313970 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GCCACAAACTTCTCTTTGGGTC -3'
(R):5'- GCTTATACTTAGTCCCTGGGC -3'

Sequencing Primer
(F):5'- GGGTCTATATAACACGTCTCTACC -3'
(R):5'- CACTGAGCAGGCTTTATGAACCTG -3'
Posted On2014-12-29