Incidental Mutation 'R2964:Cwh43'
ID255963
Institutional Source Beutler Lab
Gene Symbol Cwh43
Ensembl Gene ENSMUSG00000029154
Gene Namecell wall biogenesis 43 C-terminal homolog
SynonymsC130090K23Rik
MMRRC Submission 040520-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R2964 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location73406075-73453435 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 73408336 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000069563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031040] [ENSMUST00000065543]
Predicted Effect probably benign
Transcript: ENSMUST00000031040
SMART Domains Protein: ENSMUSP00000031040
Gene: ENSMUSG00000029154

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
transmembrane domain 91 113 N/A INTRINSIC
transmembrane domain 123 140 N/A INTRINSIC
transmembrane domain 191 213 N/A INTRINSIC
transmembrane domain 236 258 N/A INTRINSIC
transmembrane domain 275 297 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
transmembrane domain 351 368 N/A INTRINSIC
transmembrane domain 395 412 N/A INTRINSIC
Pfam:Exo_endo_phos 435 580 5.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065543
SMART Domains Protein: ENSMUSP00000069563
Gene: ENSMUSG00000029154

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
transmembrane domain 91 113 N/A INTRINSIC
transmembrane domain 123 140 N/A INTRINSIC
transmembrane domain 191 213 N/A INTRINSIC
low complexity region 242 257 N/A INTRINSIC
transmembrane domain 260 282 N/A INTRINSIC
transmembrane domain 309 326 N/A INTRINSIC
Pfam:Exo_endo_phos 345 494 4.7e-9 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,626,405 R511* probably null Het
Acox3 T C 5: 35,605,267 I495T possibly damaging Het
Acsl3 A G 1: 78,694,294 S302G probably benign Het
Ap1s1 T C 5: 137,037,503 D148G probably damaging Het
Asprv1 T A 6: 86,628,366 C65S probably damaging Het
Cdkal1 A G 13: 29,444,035 S39P unknown Het
Chrna2 T C 14: 66,149,368 V321A possibly damaging Het
Chsy1 G A 7: 66,172,164 G716R probably damaging Het
Col13a1 G A 10: 61,961,331 R106W probably damaging Het
Cul9 A G 17: 46,502,228 V2355A probably damaging Het
Dbi C T 1: 120,120,116 probably benign Het
Dync1h1 G A 12: 110,641,026 probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Fstl3 T C 10: 79,781,223 V200A probably benign Het
Gpr45 G A 1: 43,032,508 D104N possibly damaging Het
Gsdma2 T C 11: 98,657,259 S184P probably damaging Het
Gtf2ird1 T C 5: 134,357,684 probably null Het
H2-T22 A G 17: 36,040,645 L231S probably damaging Het
Hrh4 T C 18: 13,022,369 C322R probably benign Het
Ing1 T A 8: 11,561,641 S26R probably benign Het
Kif3a A T 11: 53,578,930 I123F probably damaging Het
Lrp6 T C 6: 134,467,526 E1127G probably damaging Het
Ltf G T 9: 111,028,472 C443F possibly damaging Het
Mdc1 A T 17: 35,853,637 Q1359L possibly damaging Het
Mdga1 A T 17: 29,852,468 I393N probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Myo3a T C 2: 22,340,256 V509A possibly damaging Het
Nav2 C T 7: 49,557,032 T1535I probably damaging Het
Nlrp4d G T 7: 10,378,329 S626* probably null Het
Nup188 T A 2: 30,325,346 I732K probably damaging Het
Olfr1453 C T 19: 13,028,048 A94T probably benign Het
Olfr340 T C 2: 36,452,767 F61L probably damaging Het
Olfr355 G A 2: 36,927,407 R236C probably benign Het
Oprm1 T C 10: 6,788,914 S14P probably damaging Het
Pigr G A 1: 130,841,535 V28M probably damaging Het
Pnpla2 C T 7: 141,458,478 L215F probably damaging Het
Pth T C 7: 113,385,929 H79R probably benign Het
Rasal1 T A 5: 120,671,620 L530Q probably damaging Het
Sdccag8 A T 1: 176,948,371 K616M possibly damaging Het
Slc4a5 C T 6: 83,296,669 T997I probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Trav7d-4 C T 14: 52,770,127 Q26* probably null Het
Zcchc8 A G 5: 123,720,867 S22P probably benign Het
Other mutations in Cwh43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Cwh43 APN 5 73421489 missense possibly damaging 0.93
IGL02225:Cwh43 APN 5 73421567 missense probably damaging 1.00
R0115:Cwh43 UTSW 5 73418027 missense probably damaging 1.00
R0423:Cwh43 UTSW 5 73416742 missense probably benign 0.00
R0481:Cwh43 UTSW 5 73418027 missense probably damaging 1.00
R0786:Cwh43 UTSW 5 73408183 nonsense probably null
R1635:Cwh43 UTSW 5 73434310 missense probably damaging 1.00
R1729:Cwh43 UTSW 5 73408218 missense probably damaging 0.99
R1784:Cwh43 UTSW 5 73408218 missense probably damaging 0.99
R1927:Cwh43 UTSW 5 73453074 missense probably benign 0.27
R2070:Cwh43 UTSW 5 73421517 missense probably damaging 1.00
R2104:Cwh43 UTSW 5 73421530 missense possibly damaging 0.93
R2136:Cwh43 UTSW 5 73415054 missense probably benign 0.01
R2517:Cwh43 UTSW 5 73421543 missense probably benign 0.04
R3713:Cwh43 UTSW 5 73438492 missense probably damaging 0.99
R4291:Cwh43 UTSW 5 73411932 missense probably benign 0.35
R4333:Cwh43 UTSW 5 73441379 missense probably damaging 0.99
R4869:Cwh43 UTSW 5 73428673 critical splice donor site probably null
R5071:Cwh43 UTSW 5 73423913 critical splice acceptor site probably null
R5309:Cwh43 UTSW 5 73416767 missense probably benign
R5451:Cwh43 UTSW 5 73431913 missense probably benign 0.14
R5471:Cwh43 UTSW 5 73408231 nonsense probably null
R5601:Cwh43 UTSW 5 73417940 splice site probably null
R5652:Cwh43 UTSW 5 73418141 missense probably damaging 0.99
R5820:Cwh43 UTSW 5 73428632 nonsense probably null
R5823:Cwh43 UTSW 5 73411870 missense probably benign 0.27
R6351:Cwh43 UTSW 5 73411905 missense possibly damaging 0.55
R7467:Cwh43 UTSW 5 73411968 missense probably damaging 0.99
R7583:Cwh43 UTSW 5 73434289 missense probably benign 0.00
R7788:Cwh43 UTSW 5 73415034 missense probably damaging 1.00
R8070:Cwh43 UTSW 5 73421463 missense possibly damaging 0.64
R8282:Cwh43 UTSW 5 73434229 missense probably damaging 0.97
Z1177:Cwh43 UTSW 5 73430470 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCTCTACCACGGACTGAG -3'
(R):5'- ATGTTTCCCTCTCAGGCATAG -3'

Sequencing Primer
(F):5'- ACGGACTGAGCCCCATGATC -3'
(R):5'- GAGGTCCTGAGTTCAATTCCAAGC -3'
Posted On2014-12-29