Incidental Mutation 'R2964:Zcchc8'
ID255965
Institutional Source Beutler Lab
Gene Symbol Zcchc8
Ensembl Gene ENSMUSG00000029427
Gene Namezinc finger, CCHC domain containing 8
Synonyms5730565F05Rik
MMRRC Submission 040520-MU
Accession Numbers

Genbank: NM_027494; MGI: 1917900

Is this an essential gene? Possibly non essential (E-score: 0.419) question?
Stock #R2964 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location123698294-123721100 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123720867 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 22 (S22P)
Ref Sequence ENSEMBL: ENSMUSP00000142363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031376] [ENSMUST00000196282] [ENSMUST00000200503]
Predicted Effect probably benign
Transcript: ENSMUST00000031376
AA Change: S22P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000031376
Gene: ENSMUSG00000029427
AA Change: S22P

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 48 83 N/A INTRINSIC
ZnF_C2HC 231 247 4.13e-3 SMART
PSP 286 338 3.04e-27 SMART
low complexity region 410 434 N/A INTRINSIC
low complexity region 464 500 N/A INTRINSIC
low complexity region 520 527 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196001
Predicted Effect probably benign
Transcript: ENSMUST00000196282
AA Change: S22P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000142363
Gene: ENSMUSG00000029427
AA Change: S22P

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 48 83 N/A INTRINSIC
ZnF_C2HC 231 247 4.13e-3 SMART
PSP 286 338 3.04e-27 SMART
low complexity region 410 434 N/A INTRINSIC
low complexity region 464 500 N/A INTRINSIC
low complexity region 520 527 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196333
Predicted Effect probably benign
Transcript: ENSMUST00000198826
Predicted Effect probably benign
Transcript: ENSMUST00000200503
Meta Mutation Damage Score 0.0652 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (43/43)
Allele List at MGI

All alleles(12) : Gene trapped(12)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,626,405 R511* probably null Het
Acox3 T C 5: 35,605,267 I495T possibly damaging Het
Acsl3 A G 1: 78,694,294 S302G probably benign Het
Ap1s1 T C 5: 137,037,503 D148G probably damaging Het
Asprv1 T A 6: 86,628,366 C65S probably damaging Het
Cdkal1 A G 13: 29,444,035 S39P unknown Het
Chrna2 T C 14: 66,149,368 V321A possibly damaging Het
Chsy1 G A 7: 66,172,164 G716R probably damaging Het
Col13a1 G A 10: 61,961,331 R106W probably damaging Het
Cul9 A G 17: 46,502,228 V2355A probably damaging Het
Cwh43 T C 5: 73,408,336 probably benign Het
Dbi C T 1: 120,120,116 probably benign Het
Dync1h1 G A 12: 110,641,026 probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Fstl3 T C 10: 79,781,223 V200A probably benign Het
Gpr45 G A 1: 43,032,508 D104N possibly damaging Het
Gsdma2 T C 11: 98,657,259 S184P probably damaging Het
Gtf2ird1 T C 5: 134,357,684 probably null Het
H2-T22 A G 17: 36,040,645 L231S probably damaging Het
Hrh4 T C 18: 13,022,369 C322R probably benign Het
Ing1 T A 8: 11,561,641 S26R probably benign Het
Kif3a A T 11: 53,578,930 I123F probably damaging Het
Lrp6 T C 6: 134,467,526 E1127G probably damaging Het
Ltf G T 9: 111,028,472 C443F possibly damaging Het
Mdc1 A T 17: 35,853,637 Q1359L possibly damaging Het
Mdga1 A T 17: 29,852,468 I393N probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Myo3a T C 2: 22,340,256 V509A possibly damaging Het
Nav2 C T 7: 49,557,032 T1535I probably damaging Het
Nlrp4d G T 7: 10,378,329 S626* probably null Het
Nup188 T A 2: 30,325,346 I732K probably damaging Het
Olfr1453 C T 19: 13,028,048 A94T probably benign Het
Olfr340 T C 2: 36,452,767 F61L probably damaging Het
Olfr355 G A 2: 36,927,407 R236C probably benign Het
Oprm1 T C 10: 6,788,914 S14P probably damaging Het
Pigr G A 1: 130,841,535 V28M probably damaging Het
Pnpla2 C T 7: 141,458,478 L215F probably damaging Het
Pth T C 7: 113,385,929 H79R probably benign Het
Rasal1 T A 5: 120,671,620 L530Q probably damaging Het
Sdccag8 A T 1: 176,948,371 K616M possibly damaging Het
Slc4a5 C T 6: 83,296,669 T997I probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Trav7d-4 C T 14: 52,770,127 Q26* probably null Het
Other mutations in Zcchc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01341:Zcchc8 APN 5 123704569 missense probably benign 0.43
IGL01536:Zcchc8 APN 5 123720719 critical splice donor site probably null
IGL02083:Zcchc8 APN 5 123700918 missense probably damaging 1.00
IGL02838:Zcchc8 APN 5 123719483 splice site probably benign
3-1:Zcchc8 UTSW 5 123709481 missense probably damaging 1.00
PIT4515001:Zcchc8 UTSW 5 123700932 missense probably benign 0.23
R0127:Zcchc8 UTSW 5 123707337 missense probably damaging 1.00
R1134:Zcchc8 UTSW 5 123717027 missense probably damaging 1.00
R1604:Zcchc8 UTSW 5 123700658 missense probably benign 0.00
R1744:Zcchc8 UTSW 5 123700373 nonsense probably null
R2216:Zcchc8 UTSW 5 123707403 missense probably damaging 1.00
R2303:Zcchc8 UTSW 5 123700597 missense probably benign 0.00
R2877:Zcchc8 UTSW 5 123700703 missense probably benign 0.05
R2966:Zcchc8 UTSW 5 123720867 missense probably benign 0.00
R6831:Zcchc8 UTSW 5 123700909 missense probably damaging 1.00
R7908:Zcchc8 UTSW 5 123720720 critical splice donor site probably benign
R7989:Zcchc8 UTSW 5 123720720 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- TTCTTGGAAATTCCGCCGTG -3'
(R):5'- TTGTAGTCTCCGTCCAGGAC -3'

Sequencing Primer
(F):5'- AGTGCCAAGTGACACCCG -3'
(R):5'- AGGACCCGCCCCTAGAC -3'
Posted On2014-12-29