Incidental Mutation 'R2964:Ap1s1'
ID255967
Institutional Source Beutler Lab
Gene Symbol Ap1s1
Ensembl Gene ENSMUSG00000004849
Gene Nameadaptor protein complex AP-1, sigma 1
SynonymsAP19
MMRRC Submission 040520-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R2964 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location137034993-137046135 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 137037503 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 148 (D148G)
Ref Sequence ENSEMBL: ENSMUSP00000115941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041543] [ENSMUST00000111080] [ENSMUST00000144303] [ENSMUST00000150603] [ENSMUST00000186451] [ENSMUST00000190827]
Predicted Effect probably benign
Transcript: ENSMUST00000041543
SMART Domains Protein: ENSMUSP00000048273
Gene: ENSMUSG00000037428

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 110 115 N/A INTRINSIC
low complexity region 147 169 N/A INTRINSIC
low complexity region 179 197 N/A INTRINSIC
low complexity region 218 231 N/A INTRINSIC
coiled coil region 307 412 N/A INTRINSIC
low complexity region 434 450 N/A INTRINSIC
low complexity region 478 488 N/A INTRINSIC
low complexity region 490 504 N/A INTRINSIC
low complexity region 510 518 N/A INTRINSIC
coiled coil region 576 613 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111080
AA Change: D115G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106709
Gene: ENSMUSG00000004849
AA Change: D115G

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 142 5.6e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000144303
AA Change: D115G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120895
Gene: ENSMUSG00000004849
AA Change: D115G

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 142 5.2e-65 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000150603
AA Change: D148G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115941
Gene: ENSMUSG00000004849
AA Change: D148G

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 34 175 2.4e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154183
Predicted Effect probably benign
Transcript: ENSMUST00000186451
SMART Domains Protein: ENSMUSP00000140735
Gene: ENSMUSG00000037428

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 110 115 N/A INTRINSIC
low complexity region 147 169 N/A INTRINSIC
low complexity region 179 197 N/A INTRINSIC
low complexity region 218 231 N/A INTRINSIC
coiled coil region 307 412 N/A INTRINSIC
low complexity region 434 450 N/A INTRINSIC
low complexity region 478 488 N/A INTRINSIC
low complexity region 490 504 N/A INTRINSIC
low complexity region 510 518 N/A INTRINSIC
coiled coil region 576 613 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190827
SMART Domains Protein: ENSMUSP00000140815
Gene: ENSMUSG00000037428

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 110 115 N/A INTRINSIC
low complexity region 147 169 N/A INTRINSIC
low complexity region 179 197 N/A INTRINSIC
low complexity region 218 231 N/A INTRINSIC
coiled coil region 307 412 N/A INTRINSIC
low complexity region 434 450 N/A INTRINSIC
low complexity region 478 488 N/A INTRINSIC
low complexity region 490 504 N/A INTRINSIC
low complexity region 510 518 N/A INTRINSIC
coiled coil region 576 613 N/A INTRINSIC
Meta Mutation Damage Score 0.9219 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the clathrin coat assembly complex which links clathrin to receptors in coated vesicles. These vesicles are involved in endocytosis and Golgi processing. This protein, as well as beta-prime-adaptin, gamma-adaptin, and the medium (mu) chain AP47, form the AP-1 assembly protein complex located at the Golgi vesicle. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik C T 7: 41,626,405 R511* probably null Het
Acox3 T C 5: 35,605,267 I495T possibly damaging Het
Acsl3 A G 1: 78,694,294 S302G probably benign Het
Asprv1 T A 6: 86,628,366 C65S probably damaging Het
Cdkal1 A G 13: 29,444,035 S39P unknown Het
Chrna2 T C 14: 66,149,368 V321A possibly damaging Het
Chsy1 G A 7: 66,172,164 G716R probably damaging Het
Col13a1 G A 10: 61,961,331 R106W probably damaging Het
Cul9 A G 17: 46,502,228 V2355A probably damaging Het
Cwh43 T C 5: 73,408,336 probably benign Het
Dbi C T 1: 120,120,116 probably benign Het
Dync1h1 G A 12: 110,641,026 probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw21 A G 9: 109,145,510 I314T probably benign Het
Fstl3 T C 10: 79,781,223 V200A probably benign Het
Gpr45 G A 1: 43,032,508 D104N possibly damaging Het
Gsdma2 T C 11: 98,657,259 S184P probably damaging Het
Gtf2ird1 T C 5: 134,357,684 probably null Het
H2-T22 A G 17: 36,040,645 L231S probably damaging Het
Hrh4 T C 18: 13,022,369 C322R probably benign Het
Ing1 T A 8: 11,561,641 S26R probably benign Het
Kif3a A T 11: 53,578,930 I123F probably damaging Het
Lrp6 T C 6: 134,467,526 E1127G probably damaging Het
Ltf G T 9: 111,028,472 C443F possibly damaging Het
Mdc1 A T 17: 35,853,637 Q1359L possibly damaging Het
Mdga1 A T 17: 29,852,468 I393N probably damaging Het
Mnd1 C A 3: 84,134,109 C62F probably benign Het
Myo3a T C 2: 22,340,256 V509A possibly damaging Het
Nav2 C T 7: 49,557,032 T1535I probably damaging Het
Nlrp4d G T 7: 10,378,329 S626* probably null Het
Nup188 T A 2: 30,325,346 I732K probably damaging Het
Olfr1453 C T 19: 13,028,048 A94T probably benign Het
Olfr340 T C 2: 36,452,767 F61L probably damaging Het
Olfr355 G A 2: 36,927,407 R236C probably benign Het
Oprm1 T C 10: 6,788,914 S14P probably damaging Het
Pigr G A 1: 130,841,535 V28M probably damaging Het
Pnpla2 C T 7: 141,458,478 L215F probably damaging Het
Pth T C 7: 113,385,929 H79R probably benign Het
Rasal1 T A 5: 120,671,620 L530Q probably damaging Het
Sdccag8 A T 1: 176,948,371 K616M possibly damaging Het
Slc4a5 C T 6: 83,296,669 T997I probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Trav7d-4 C T 14: 52,770,127 Q26* probably null Het
Zcchc8 A G 5: 123,720,867 S22P probably benign Het
Other mutations in Ap1s1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Ap1s1 APN 5 137041809 missense probably damaging 1.00
IGL01621:Ap1s1 APN 5 137041804 nonsense probably null
IGL02661:Ap1s1 APN 5 137037473 missense probably benign 0.01
IGL02850:Ap1s1 APN 5 137041780 missense possibly damaging 0.91
R1597:Ap1s1 UTSW 5 137043241 missense probably damaging 0.99
R2257:Ap1s1 UTSW 5 137041779 missense possibly damaging 0.94
R2966:Ap1s1 UTSW 5 137037503 missense probably damaging 1.00
R5690:Ap1s1 UTSW 5 137037379 unclassified probably benign
R6164:Ap1s1 UTSW 5 137037386 unclassified probably benign
R7650:Ap1s1 UTSW 5 137045533 missense probably benign
Z1176:Ap1s1 UTSW 5 137037470 missense probably damaging 1.00
Z1177:Ap1s1 UTSW 5 137045233 intron probably benign
Predicted Primers PCR Primer
(F):5'- ATTTAGACAGCAGGGCGTG -3'
(R):5'- ACTCACGACGGAACTCACTG -3'

Sequencing Primer
(F):5'- CGTGATGGGGGCCAGAC -3'
(R):5'- ATCGGTTCAAGGACAGCTTC -3'
Posted On2014-12-29